Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 16P
The sequence of a segment of mRNA, beginning with the initiation codon, is given here, along with the corresponding sequences from several mutant strains.
Normal AUGACACAUCGAGGGGUGGUAAACCCUAAG...
Mutant 1 AUGACACAUCCAGGGGUGGUAAACCCUAAG...
Mutant 2 AUGACACAUCGAGGGUGGUAAACCCUAAG...
Mutant 3 AUGACGCAUCGAGGGGUGGUAAACCCUAAG...
Mutant 4 AUGACACAUCGAGGGGUUGGUAAACCCUAAG...
Mutant 5 AUGACACAUUGAGGGGUGGUAAACCCUAAG...
Mutant 6 AUGACAUUUACCACCCCUCGAUGCCCUAAG...
a. | Indicate the type of mutation present in each, and translate the mutated portion of the sequence into an amino acid sequence in each case. |
b. | Which of the mutations could be reverted by treatment with EMS (ethylmethane sulfonate; see Fig. 7.14)? With proflavin? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What will be the overall anti-codon sequence in tRNA for this mRNA?
5’-GUAGCCUUAUCUAGCGAUCACCGUCCGUAUUACUAGUGGCCAGACUCUUUUCACCAUGUAUAGUUG-3’
give the amino acids specified by the following bacterial mRNA sequences. a. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′ b. 5′ –AGGGAAAUCAGAUGUAUAUAUAUAUAUGA–3′ c. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′ d. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′
The following is part of the non-template strand of DNA for a gene.
5'-TACTATCATGAGAGATAGGAG-3'
Which of these sequences corresponds to the mRNA after transcription
A)5'-AUGAUAGUACUCUCUAUCCUC-3'
B) 5'-TACTATCATGAGAGATAGGAG-3'
c) 5'-ATGATAGTACTCTCTATCCTC-3'
d) 5'-UACUAUCAUGAGAGAUAGGAG-3'
E) N-Tyr-Tyr-His-Glu-Thr-C
Chapter 8 Solutions
Genetics: From Genes to Genomes
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’ AAUGGAACGUCGGUACUGCCAUCGCAUUAGUACCAUGGCAAGCUGAAGC 3’arrow_forwardThe following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?arrow_forwardGiven the template DNA sequence: 3’ - TAC - CAG - GTT - ACC - ATC - 5’ A.) What will be the mRNA requence corresponding to the template DNA sequence? B.) What is the amino acid sequence in letter A? ( e.g. Arg, Phe, etc.) C.) If the coding sequence of the dsDNA will "serve" as the template for transcription, what is the corresponding mRNA sequence? D.) With the mRNA transcript in letter C, what will be the amino acid sequence? ( e.g. Arg, Phe, etc.)arrow_forward
- Consider the following mRNA base sequence 5' CUG-CAC 3' (a) What dipeptide is coded for by this mRNA? (b) What dipeptide is formed if a mutation converts CUG to CUU? (c) What dipeptide is formed if a mutation converts CAC to CGC? (d) What dipeptide is formed if a mutation converts CUG to CUU and CAC to CGC?arrow_forwardGiven the DNA sequence TATAGCACTGAT, which of the following is the correct complementary mRNA sequence that would be produced? TUTUCGUGUCTU AUAUCGUGACUA ATATCGTGACTA CGCATGTCAGC None of the abovearrow_forwardThe DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ Draw boxes around any structures or bases that were added to the RNA during processing.arrow_forward
- NASA has identified a new microbe present on Mars and requests that you determine the genetic code of this organism. To accomplish this goal, you isolate an extract from this microbe that contains all the components necessary for protein synthesis except mRNA. Synthetic mRNAs are added to this extract and the resulting polypeptides are analyzed: Synthetic mRNA Resulting Polypeptides AAAAAAAAAAAAAAAA Lysine-Lysine-Lysine etc. CACACACACACACACA Threonine-Histidine-Threonine-Histidine etc. AACAACAACAACAACA Threonine-Threonine-Threonine etc. Glutamine-Glutamine-Glutamine etc. Asparagine-Asparagine-Asparagine etc. From these data, what specifics can you conclude about the microbe’s genetic code? What is the sequence of the anticodon loop of a tRNA carrying a threonine? If you found that this microbe contained 61 different tRNAs, what could you speculate about the fidelity of translation in this organism?arrow_forwardWhat is the consensus sequence of the following six DNA sequences?GGCATTGACTGCCATTGTCACGCATAGTCAGGAAATGGGAGGCTTTGTCAGGCATAGTCAarrow_forwardAssume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…arrow_forward
- (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAAGGACGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Arg Thr Val) (b.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGGAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGCCUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Pro Leu Gly Thr Val) (c.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCTCAAATCCCTGCCAT 3' Then the mRNA sequence will be, 5' GAUAUUCCGAGUUUAGGGACGGUA 3' Amino acids - (Asp Leu Pro Ser Leu Gly Thr Val) (d.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATCCCTCCAT 3¹ Then the mRNA sequence will be, 5' GAUAUUCCGCGUUUAGGGAGGUA 3' Amino acids - (Asp Leu Pro Arg Leu Gly Arg).As the last sequence contains only 2 bases it will not represent any amino acid. question: Choose the types of mutations caused by the changes in parts…arrow_forward-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTTarrow_forwardWhich of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY