Concept explainers
Arrange the following list of eukaryotic gene elements in the order in which they would appear in the genome and in the direction traveled by RNA polymerase along the gene. Assume the gene’s single intron interrupts the open reading frame. Note that some of these names are abbreviated and thus do not distinguish between elements in DNA versus RNA. For example, splice-donor site is an abbreviation for DNA sequences transcribed into the splice-donor site because splicing takes place on the gene’s RNA transcript, not on the gene itself. Geneticists often use this kind of shorthand for simplicity, even though it is imprecise. (a) splice-donor site; (b)3′ UTR; (c) promoter; (d) stop codon; (e)
Trending nowThis is a popular solution!
Chapter 8 Solutions
Genetics: From Genes to Genomes
- Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases will the pre mRNA transcript be? Explain briefly. What is the maximum number of amino acids that could make up the protein product from the final mRNA? Explain briefly.arrow_forwardThe following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?arrow_forwardShown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?arrow_forward
- Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?arrow_forwardHuman wildtype and mutant alleles are identical in sequence except for a single base-pair substitution that changes one nucleotide towards the end of intron 2. The wildtype and mutant sequences of the affected portion of the mRNA are listed in the following table. Explain how a single base substitution could alter the reading frame, which could result in a physiological disorder?arrow_forwardGiven the following mRNA transcript: 5’-UUUGGCAUGGGUAUCGUAGAGAUGGAAUUCAUAGUGGAGUAA-3’ What is the one-letter abbreviation of the protein product of the mRNA transcript?arrow_forward
- A eukaryotic gene has two introns and three exons. The first intron closest to the promoter is 157 bp long and the second, farthest from the promoter, is 236. The three exons, in sequence from closest to farthest from the promoter, are 213 bp, 180 bp and 423 bp respectively. Draw the structure you would obtain if you hybridized the template strand of the transcribed region of this gene and three hundred base pairs of additional flanking DNA at each end with the mRNA produced from this gene. Can you estimate the size in amino acid residues of the protein coded for by this gene? Please justify you answer.arrow_forwardIn the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.arrow_forwardIn the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region. 4C. In NOT more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus?arrow_forward
- Considering that prokaryote genomes do not have large introns, how is it possible to move a eukaryotic gene into a transformed bacterium, since they lack a spliceosome?arrow_forwardShown below is a schematic drawing of a gene, with the transcription unit divided into numbered regions. The arrows (;) indicate transcription initiation sites, "D" indicates a splice donor site, "A" indicates a splice acceptor site, and "An" indicates a polyadenylation signal. Give all the possible fully processed mRNAs that could be produced from transcripts of this gene (you don't need to draw anything, just list the regions that would be included in each mRNA by number).arrow_forwardGiven the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education