Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 41P
Do you think each of the following types of mutations would have very severe effects, mild effects, or no effect at all?
| a. | Nonsense mutations occurring in the sequences encoding amino acids near the N terminus of the protein |
| b. | Nonsense mutations occurring in the sequences encoding amino acids near the C terminus of the protein |
| c. | Frameshift mutations occurring in the sequences encoding amino acids near the N terminus of the protein |
| d. | Frameshift mutations occurring in the sequences encoding amino acids near the C terminus of the protein |
| e. | Silent mutations |
| f. | Conservative missense mutations |
| g. | Nonconservative missense mutations affecting the active site of the protein |
| h. | Nonconservative missense mutations not in the active site of the protein |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Do you think each of the following types of mutationswould have very severe effects, mild effects, or no effectat all?a. Nonsense mutations occurring in the sequences encoding amino acids near the N terminus of the proteinb. Nonsense mutations occurring in the sequences encoding amino acids near the C terminus of the proteinc. Frameshift mutations occurring in the sequences encoding amino acids near the N terminus of the protein d. Frameshift mutations occurring in the sequencesencoding amino acids near the C terminus of theproteine. Silent mutationsf. Conservative missense mutationsg. Nonconservative missense mutations affecting theactive site of the proteinh. Nonconservative missense mutations not in the active site of the protein
How might a single base substitution in the sequence of a gene affect the amino acid sequence of a protein encoded by the gene, and why?
A - It is not possible for a single base substitution to affect protein structure, because each codon is three bases long.
B-
The amino acid sequence would be substantially altered, because the reading frame would change with a single base substitution.
C -
Only a single amino acid could change, because the reading frame is unaffected.
D-
All amino acids following the substitution would be affected, because the reading frame would be shifted.
Which of the following mutations would have the greatest negative impact on the protein product of a gene?
A.
a single base deletion close to the end of the coding region of a gene.
B.
a single base insertion near the start of the coding region of the gene
C.
a base-pair substitution
D.
a deletion of three bases near the middle of the gene
Chapter 8 Solutions
Genetics: From Genes to Genomes
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You are studying a mutation in mice, which acts dominantly. Mice that have only one copy of the allele carrying this mutation have a kinky tail phenotype. You identify the gene that the mutation affects and find that the codon that encodes the second amino acid in the predicted protein has been mutated to a stop codon. Would you characterize this mutation as a loss-of-function or a gain-of-function and what specific subtype (hypermorphic, antimorphic, etc. ) within these categories? Explain your reasoning.”arrow_forwardWhat three different types of mutations involve changes in a single base, and what effect can each of them have on a coding sequence? Which type is the most common? Which type has the most severe effect on the function of the encoded protein?arrow_forwardA small section of a gene for a protein has the following nucleotide sequence: CCT AAG GAT TCA CTT Which of the following mutations would cause a missense mutation in the sequence shown above? a. Replacement of first guanine base with cytosine base b. Replacement of first thymine base with cytosine base c. Replacement of second thymine base with adenine base d. Replacement of seond guanine base with adenine basearrow_forward
- Which do you think would be more likely to have an effect on protein function: a silent mutation or a missense mutation? Explain your answerarrow_forwardWhile characterizing a mutation in a gene of interest, you discover that the mutation involves an insertion within the coding sequence of the gene. You suspect that the inserted sequence is a transposon and would like to determine which of the three major transposon families it belongs to. What sequence elements could be looked for within the inserted sequence that would help place it in one of the three families?arrow_forwardThe following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairingarrow_forward
- Which type of mutation would expect would have no effect on a protein coding gene in eukaryotes? a.a single base substitution that creates a splice site mutation b.a single base substitution that creates a synonymous mutation c.a single base deletion that creates a frameshift near the 3' end of the open reading frame d.a single base substitution that creates a non-conservative missense mutation e.a single base substitution that creates a conservative missense mutationarrow_forwardIn a study of several families for differences in the sequence of a particular gene suspected to cause a disease. Resulting in the discovery of different mutations in the genes of some families. For each of the mutations, specify if it could change the size or the quantity of mRNA and/or protein product? What kind of change would you predict? Explain each answer briefly. d. AAG378UAG e. promoter mutation. f. one base-pair insertion into codon #765 g. deletion of whole codon #765 h. G-to-A substitution in the 5' UTR i. insertion of 100 base pairs into the fourth intron (this insertion does not alter splicing).arrow_forwardWhich of the following mutations in the protein-coding region of a gene is more likely to lead to complete loss of function of the encoded protein: an insertion of six nucleotides or a deletion of two nucleotides? Briefly explain your answer.arrow_forward
- a. Some antibiotics, such as rifampin, interfere with the function of RNA polymerase. What biological process is rifampin disrupting? b. Some antibiotic-resistant M. tuberculosis bacteria have a single point mutation (CàT) in the rpoB gene that causes an amino acid change from serine (a polar amino acid) to leucine (a non-polar amino acid). What type of mutation is this? Do you expect this to have no effect, a small effect, or a large effect on the polypeptide produced? Explain your reasoning. c. The rpoB gene encodes a subunit of the bacterial RNA polymerase protein. The point mutation described in Question 2 causes a change in protein folding, which leads to the inability of the rifampin antibiotic to bind to the RNA polymerase. Which level(s) of protein structure is/are affected by this change?arrow_forwardDefine FOUR (4) types of point mutations within coding sequencesarrow_forwardA mutant strain of bacteria is isolated in which the amino acid glutamine is often erroneously substituted for glutamic acid during protein synthesis. What kind of mutation might be underlying this defect? How could you test this hypothesis?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY