Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 39P
| a. | Very few if any eukaryotic genes contain tracts with more than 25 As or Ts in a row, yet almost all eukaryotic mRNAs have a tract with more than 100 As in a row. How is this possible? |
| b. | Scientists know the |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Several examples of antisense RNA regulating translation in bacterial cells have been discovered. Molecular geneticists have also used antisense RNA to artificially control transcription in both bacterial and eukaryotic genes. If you wanted to inhibit the transcription of a bacterial gene with antisense RNA, what sequences might the antisense RNA contain?
Many eukaryotic promoter regions contain CAAT boxes with consensus sequences CAAT or CCAAT approximately 70 to 80 bases upstream from the transcription start site. How might one determine the influence of CAAT boxes on the transcription rate of a given gene?
Many promoter regions contain CAAT boxes containing consensus sequences CAAT or CCAAT approximately 70 to 80 bases upstream from the transcription start site. How might one determine the influence of CAAT boxes on the transcription rate of a given gene?
Chapter 8 Solutions
Genetics: From Genes to Genomes
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein. The nucleotides are numbered 1 to 100. a)Although the transcription start site begins at the underlined C/G, which of the following is the nucleotide sequences needed upstream for transcription to actually occur? b)What are the first 15 nucleotides of the mRNA? c)What are the first 5 amino acids translated from the resulting mRNA? d)A different mutation results in the substitution of the T/A base pair at position 30 (shown in bold and underlined) with a G/C base pair. How would this mutation affect the sequence of the protein that is produced?arrow_forwardWith several molecular biology techniques, researchers identified that the intertwined sequence could be naturally transcribed using a promoter located 13 kilobases upstream that of p16INK4A. In addition, the transcription of this gene results in a primary transcript that is read in a different reading frame and is alternatively spliced compared to the transcript of p16INK4A. The resulting protein has been called ARF (Alternative Reading Frame). In your own words and with a diagram, describe the DNA, RNA and proteins encoded in this region.arrow_forward. Another class of suppressor mutations, not describedin the chapter, are mutations that suppress missensemutations.a. Why would bacterial strains carrying such missense suppressor mutations generally grow moreslowly than strains carrying nonsense suppressormutations?b. What other kinds of mutations can you imagine ingenes encoding components needed for gene expression that would suppress a missense mutationin a protein-coding gene?arrow_forward
- The hunchback gene contains a 5′ transcriptional regulatory region, a 5′ UTR, a structural region (the coding sequences), and a 3′ UTR.a. What important sequences required to controlhunchback gene expression are found in the transcriptional regulatory region of hunchback?b. What sequence elements that encode specific protein domains are found in the structural region ofhunchback?c. Another important kind of sequence is located inthe 3′ UTR of the hunchback mRNA. What mightthis sequence do?arrow_forwardShown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?arrow_forwardThe following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.arrow_forward
- The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.arrow_forwardMany genes in both bacteria and eukaryotes contain numerous sequences that can cause pauses in or premature termination of transcription. Nevertheless, the transcription of these genes within a cell normally produces multiple RNA molecules thousands of nucleotides long without pausing or premature termination. However, when a single round of transcription of these genes takes place in a test tube, RNA synthesis is frequently interrupted by pauses and premature terminations, which reduce the rate at which transcription takes place and frequently shorten the lengths of the mRNA molecules produced. Most pauses and premature terminations occur when RNA polymerase temporarily backtracks (i.e., backs up) for one or two nucleotides along the DNA. Experimental findings have demonstrated that most pauses and premature terminations disappear if several RNA polymerases are simultaneously transcribing the DNA molecule. Propose an explanation for this observation of faster transcription and longer…arrow_forwardA mutation has occurred that is inhibiting transcription elongation in a strain of yeast. Preliminary tests (using S1 nuclease) show that a pre-initiation complex forms, but no open promoter is forming. a) why was s1 nuclease used? b) where do you think the mutation is occurring, and whats the significance of this mutation? How could you test your answer?arrow_forward
- A mutant strain of Salmonella bacteria carries a mutation of the rho protein that has fully activity at 37°C but is completely inactivated when the mutant strain is grown at 40°C. a)Speculate about the kind of differences you would expect to see if you compared a broad spectrum of mRNAs from the mutant strain grown at 37°C and the same spectrum of mRNAs from the strain when grown at 40°C. b)Are all the mRNAs affected by the rho protein mutation in the same way? Why or why not?arrow_forwardA. Do you have any mature transcripts that show alternative splicing? If so, give an example by naming two transcripts that differ in this way. If your gene does not have this difference, write "no". B. Do you have any transcripts that have an alternative transcription start sites? If so, give an example by naming two transcripts that differ in this way. If your gene does not have this difference, write "no". C. Do you have any transcripts that have an alternative termination sites? If so, give an example by naming two transcripts that differ in this way. If your gene does not have this difference, write "no".arrow_forward4.1 Name and discuss two transcription regulatory elements that can be found in the figure. (6)4.2. During the activation of eukaryotic transcription the promoter region needs to be accessible for the binding of transcription factors. Describe in detail one of the mechanisms involved in this process.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY