Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 7P
The following diagram describes the mRNA sequence of part of the A gene and the beginning of the B gene of phage ϕX174. In this phage, some genes are read in overlapping reading frames. For example, the code for the A gene is used for part of the B gene, but the reading frame is displaced by one base. Shown here is the single mRNA with the codons for proteins A and B indicated.
aa# 5 6 7 8 9 10 11 12 13 14 15 16
A AlaLysGluTrpAsnAsnSerLeuLysThrLysLeu
mRNA GCUAAAGAAUGGAACAACUCACUAAAAACCAAGCUG
B MetGluGlnLeuThrLysAsnGlnAla
aa# 1 2 3 4 5 6 7 8 9
Given the following amino acid (aa) changes, indicate the base change that occurred in the mRNA and the consequences for the other protein sequence.
| a. | Asn at position 10 in protein A is changed to Tyr. |
| b. | Leu at position 12 in protein A is changed to Pro. |
| c. | Gln at position 8 in protein B is changed to Leu. |
| d. | The occurrence of overlapping reading frames is very rare in nature. When it does occur, the extent of the overlap is not very long. Why do you think this is the case? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The RNA transcript of a region of T4 phage DNA contains the sequence 5’-AAAUGAGGA-3'. This sequence encodes three different polypeptides. What are they?
The figure above shows a schematic of genes and transcription control elements from phage λ. Use this figure as an aid to help you describe the molecular events involved in:
a) The establishment of lysogeny
b) The establishment of a lytic life cycle
Protein Z in the figure below depicts the activity of which bacterial Nucleoid Associated Protein that may silence gene promoters (select one)?
A. Protein HU
B. Histone H3
C. Dps
D. Integration Host Factor
E. H-NS
Chapter 8 Solutions
Genetics: From Genes to Genomes
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Shown below are three genes (gene 1, gene 2, and gene 3) located on the same bacterial chromosome. a) Indicate where on the diagram you would find the following for each gene: Promoter (p1 for gene 1, p2 for gene 2, and p3 for gene 3) Transcription termination site (tts1, tts2, and tts3) Start codon (start1, start2, and start3) Stop codon (stop1, stop2, and stop3) Template strand (ts1, ts2, and ts3), the DNA strand that directs RNA synthesis Be sure to indicate the component on the appropriate molecule (DNA or RNA).arrow_forwardBacteriophage λ, after infecting a cell, can integrate into the chromosome of the cell if the repressor protein, cI, binds to and shuts down phage transcription immediately. (A strain containing a bacteriophage DNA integrated into the chromosome is called a lysogen.) The alternative fate is the production of many more viruses and lysis of the cell. In a mating, a donor strain that is a lysogen was crossed with a lysogenic recipient cell, and no phages were produced. However, when the lysogen donor strain transferred its DNA to a nonlysogenic recipient cell, the recipient cell burst, releasing a new generation of phages. b. Explain how this phenomenon relates to the PaJaMo experiment in Fig. 16.6arrow_forwardSome S. aureus strains can produce an enzyme called beta-lactamase, which breaks down beta-lactam drugs like methicillin. These strains that make beta-lactamase have a gene called mecA. Draw a diagram of the bacterial DNA encoding this gene, including the following terms: promoter, terminator, coding region.arrow_forward
- One of the reasons why phage therapy has not been applied widely is that bacteria can become resistant to bacteriophages as well, through mutations in genes encoding for specific proteins. What would be a protein in the bacterial cell that, if mutated, would make that cell resistant to phage infection?arrow_forwardImagine that you are a student in Alfred Hershey and Martha Chase’s lab in the late 1940s. You are given five test tubes containing E. Coli bacteria infected with T2 bacteriophages that have been labeled with either 32P or 35S. Unfortunately, you forget to mark the tubes and are now uncertain about which tubes is which. You performed their blender experiment and got the following results. Which tube out of these 5 contains E. Coli infected with 32P-labeled phage? Explain your answer.arrow_forwardConsider three genes in E. coli: thr+, ara+, and leu+ (which give the cell the ability to synthesize threonine, arabinose, and leucine, respectively). All three of these genes are close together on the E. coli chromosome. Phages are grown in a thr+ ara+ leu+ strain of bacteria (the donor strain). The phage lysate is collected and used to infect a strain of bacteria that is thr− ara− leu −. The recipient bacteria are then tested on selective medium lacking leucine. Bacteria that grow and form colonies on this medium (leu+ transductants) are then replica-plated on medium lacking threonine and on medium lacking arabinose to see which are thr+ and which are ara+. Another group of the recipient bacteria are tested on medium lackingthreonine. Bacteria that grow and form colonies on this medium (thr+ transductants) are then replica-plated on medium lacking leucine and onto medium lacking arabinose to see which are ara+ and which are leu+. Results from these experiments are as follows:…arrow_forward
- The bacteriophage genome consists of many genes encoding proteins that make up the head, collar, tail, and tail fibers. When these genes are transcribed following phage infection, how are these proteins synthesized, since the phage genome lacks genes essential to ribosome structure?arrow_forwardPut the following processes in order of their occurrence during expression of a eukaryotic gene: a. mRNA processing c. transcription b. translation d. RNA leaves nucleusarrow_forwardMicrob an mRNA molecule has the sequence 5'UCA GAA AUG CAC3. Which of the following best describes the tRNA that binds to the third/3rd codon of this mRNA? has anticodon AUG and the amino acid tyrosine It can have any anticodon and any amino acid Has the anticodon UAC and the amino acid methionine Has the anticodon CUU and the amino acid glutamic acid must have the anticodon TAC Has anticodon UUC and the amino acid lysinearrow_forward
- . You are interested in a eukaryotic protein involved in immunity, and you are attempting to express this protein in E. coli in order to produce large amounts of the protein. You have identified the gene and place a copy of the gene on a plasmid in E. coli next to a bacterial promoter sequence. You determine that lots of mRNA is made from your gene in your E. coli system, but the protein produced is larger and doesn't have the same properties as the eukaryotic protein you expected. What mistake have you made and how can you fix it?arrow_forwardDescribe the following a. Core enzyme RNA polymerase b. Sigma factor c. Promoter consensus sequence d. Rho Dependent Factor e. Intrinsic Factor f. Abortive Initiationarrow_forwardHere is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’- ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY