Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 20P
Chapters 6 and 7 explained that mistakes made by DNA polymerase are corrected either by proofreading mechanisms during
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
During template-directed synthesis of a new DNA strand it can happen, if there are simple repeated sequences, that either the template strand or the strand being synthesized "slips" a short distance, and this can change the number of repeating sequence units in that stretch of repeated sequence. Which of the following processes involve such slippage?
More than one answer is correct.
Options:
The increase in genomic copy number of a DNA transposon by transposition from a location behind a replication fork to a location ahead of the fork.
Introduction of indels during DNA replication.
The initial unwinding of the DNA duplex during replication by helicase.
Increasing lengths of CAG trinucleotide repeats in the huntingtin gene giving rise to Huntington disease.
Synthesis of primer by primase during DNA replication.
In eukaryotes, primers generated during DNA replication are made of _____________ and are removed by _____________.
Group of answer choices
RNA; 3'-->5' exonuclease activity of DNA polymerases
RNA; 5'-->3' exonuclease activity of DNA polymerases
DNA; 3'-->5' exonuclease activity of DNA polymerases
RNA; ribonuclease enzymes
DNA; 5'-->3' exonuclease activity of DNA polymerases
DNA; ribonuclease enzymes
DNA polymerases are capable of editing and error correction, meaning it is able to edit and correct single base error so that the gene is not affected. However, RNA polymerase has a limited capacity for error correction. Given that a single base error in either replication or transcription can lead to error in protein synthesis, suggest a brief explanation for this difference in the capability of error correction between DNA polymerase and RNA polymerase.
Chapter 8 Solutions
Genetics: From Genes to Genomes
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which DNA repair systems you think might be capable of repairing a situation where T is in one strand and G is in the complementary strand? Explain dramatically.arrow_forwardList two possible reasons why a mistake during the process of replication is more of a catastrophe than a mistake in the process of transcription. What mechanisms help to ensure the fidelity of the process of replication?arrow_forwardBelow is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…arrow_forward
- The epsilon subunit of DNA polymerase III is responsible for its _______ activity.A-5'---->3' polymerase B- Sliding clampC-3'----->5' exonuclease activity D-5'------>3' exonuclease activityarrow_forwardHuman Fbh1 helicase is important in the process of DNA replication. When a mutation occurs during the production of Fbh1, the result is a mutant Fbh1 that binds at the replication fork and prevents any helicase protein from attaching to the strand. Based on this information and the image shown, what would happen during DNA replication if this mutant helicase were present? A - Topoisomerase would unwind the DNA and an RNA primer would attach to the DNA molecule and initiate replication. The process would then stop at the blue triangle because helicase is needed to separate the strands of DNA. B - Topoisomerase would unwind the DNA, but then the process would stop at the blue triangle because helicase, the RNA primer, would not be able to attach to the DNA molecule and initiate replication. C - The process would begin at the blue triangle when topoisomerase unwinds the DNA and an RNA primer attaches to the DNA molecule and initiates replication. DNA polymerase would begin the synthesis…arrow_forwardDescribe three major differences between leading and lagging strand synthesis. What feature of DNA polymerase results in the leading and lagging strands being synthesized differentlyarrow_forward
- . Which of the following statements best describe the mismatch repair pathway?a. It is part of the 3′to 5′proofreading function of DNApolymerase.b. It acts after DNA replication by recognizing mismatched base pairs.c. It is activated by stalled replication forks.d. It is coupled to transcription.arrow_forwardDuring DNA replication in E. coli, which enzyme forms the phosphodiester bond between an RNA primer and the first incoming deoxyribonucleotide for an Okazaki fragment on the lagging strand? topoisomerase DNA polymerase III DNA helicase DNA polymerase II DNA ligase Heterogeneous nuclear RNA is typically characterized by which of the following features? it is more common in prokaryotes than in eukaryotes it contains introns, but no exons it contains more exons than introns it contains exons, but no introns it contains more introns than exonsarrow_forward. During DNA repair in prokaryotes and eukaryotes, which of the following enzymes replaces the damaged nucleotides, that were excised from the DNA strand, by inserting the correct nucleotides? topoisomerase DNA polymerase DNA helicase an exonuclease DNA ligasearrow_forward
- DNA polymerase occasionally incorporates the wrong nucleotide during DNA replication. If left unrepaired, the base-pair mismatch that results will lead to mutation in the next replication. As part of a template strand, the incorporated wrong base will direct the incorporation of a base complementary to itself, so the bases on both strands of the DNA at that position will now be different from what they were before the mismatch event. The MER-minus strain of yeast does not have a functional mismatch excision repair system, but it has normal base excision repair and nucleotide excision repair systems. Which of the following statements is correct about differences in the mutation spectrum between MER-minus and wildtype yeast? More than one answer is correct. Options: More point mutations will arise in MER-minus yeast. Fewer point mutations will arise in MER-minus yeast as compared with wildtype. Of the total point mutations that…arrow_forwardAn investigator obtains a bacterial temperature-sensitive mutation that affects a step in the process of DNA replication at 42°C but not at 30°C. She grows the cells at 30°C and, upon shifting the temperature to 42°C, she discovers that Okazaki fragments accumulate in unusually large quantities. What is the likely target affected by the temperature-sensitive mutation? primase DNA polymerase III DNA helicase DNA Ligase DNA gyrasearrow_forwardDoes the addition of a histidine tag affect DNA polymerase activity and or processivity? Give a detailed explanation.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License