Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 26P
Locate as accurately as possible the listed items that are shown on the following figure. Some items are not shown. (a) 5′ end of DNA template strand; (b) 3′ end of mRNA; (c) ribosome; (d) promoter; (e) codon; (f) an amino acid; (g) DNA polymerase; (h) 5′ UTR; (i) centromere; (j) intron; (k) anticodon; (l) N terminus; (m) 5′ end of charged tRNA; (n) RNA polymerase; (o) 3′ end of uncharged tRNA; (p) a
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A molecular researcher, Dr. Sidra Alkatini, is investigating the manifestation of a disorder in some of her lab mice models, which are lacking production of an important protein necessary for the cellular respiration pathway. The afflicted mice are short lived, and have perpetually low blood glucose levels, no matter how much food they are fed. Through sequencing, the following strand of DNA was produced:
5’ TTC CAA TTA CGC CGC TAT ACG CGC ACC ATG TTA TCA TGT TGG TGG TAG 3’
Given your expertise in genetics, she contacts you, her BFF, to help her understand the sequence and its relation to the genetic disorder she is seeing.
1)
Considering the entire DNA sequence shown above, specify the numbered codon that represents START.
a
Codon 10.
b
Codons 12-13.
c
Codon 9.
d
Codons 28-30.
2)
Indicate three motifs that justify this as being a eukaryotic sequence.
a
CAAT, TATA, ACCATGG.
b
GACA, TATAAT, AAUAA.…
A molecular researcher, Dr. Sidra Alkatini, is investigating the manifestation of a disorder in some of her lab mice models, which are lacking production of an important protein necessary for the cellular respiration pathway. The afflicted mice are short lived, and have perpetually low blood glucose levels, no matter how much food they are fed. Through sequencing, the following strand of DNA was produced:
5’ TTC CAA TTA CGC CGC TAT ACG CGC ACC ATG TTA TCA TGT TGG TGG TAG 3’
Given your expertise in genetics, she contacts you, her BFF, to help her understand the sequence and its relation to the genetic disorder she is seeing.
1)
Now that you have seen the sequence and identified some of the major motifs it contains, what are going to tell Dr. Alkatini about in relation to the genetic disorder she is seeing?
a
“Listen, Doc, it is clear there is no STOP signal in the last codon place where it normally should be.”
b
“Listen, Doc, the fact…
Remember when looking up a codon make sure it is in its mRNA form.
Below is a sample of a segment of DNA…(copy from left to right)
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’
5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’
What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids).
2.What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this? Often this type of mutation does show symptoms until middle age. What problem does this create?
3.What are three differences between a point mutation and deletion mutation
Chapter 8 Solutions
Genetics: From Genes to Genomes
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Provide a chemical explanation of why DNA synthesis proceeds in a 5'- to-3' direction.arrow_forwardWhich of the molecules of RNA is the most likely to fold into a specific structure as a result of intramolecular (within itself) base-pairing? Explain. 5′-CCCUAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAGGG-3′ 5′-UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG-3′ 5′-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3′ 5′-GGAAAAGGAGAUGGGCAAGGGGAAAAGGAGAUGGGCAAGG-3′arrow_forwardWhy do DNA chips often contain segments derived from cDNA rather than genomic DNA segments?arrow_forward
- Let’s say that you want to find out the difference in nucleotide sequence among two DNA strands, one of which is isolated from the liver of a liver cancer patient and the other one is isolated from the liver of a healthy individual. How you can do that, please explain in detailsarrow_forwardYou are characterizing a DNA-binding protein, and have used genetic experiments to identify a domain required for the interaction of the protein with DNA. Your secondary structure analysis software predicts that the domain forms a β helix, but you are unconvinced. What experiments could you perform to confirm the presence of a β helix in this region?arrow_forwardGiven the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?arrow_forward
- Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.arrow_forwardIf an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?arrow_forwardExamine Figure 16.2b. Why do you think the motif of the DNA-binding protein shown is called a zinc-finger motif?arrow_forward
- Refer to a genetic code table for the question. below is a portion of the template strand of a particular gene sequence. Which of the following would be the correct sequence of amino acids in the protein that this portion of the gene encodes? (Note that there are no entrance in this gene sequence, and this portion is found in the middle of the coding sequence, past the start codon, so you should transcribe and translate the entire portion of this sequence) template DNA : 3' - ACG GGT TCC TTT AAC GCG TAG -5' A) Thr-Gly-Ser-Phe-Asn-Ala B) Cys-Pro-Arg-Lys-Leu-Arg-Ile C) there is not enough information given to determine the amino acid sequence of this portion of the gene .arrow_forwardConsider this nucleotide sequence of DNA strand in the image provided. If this strand is the sense strand, Give the correct nucleotide sequence of the RNA produced after transcription. If the RNA formed in #1 is already a functional mRNA and will be used to synthesize proteins, how many codons are present here that will actually code for amino acids? What is the sequence of the stop codon in this mRNA? What is the sequence of the 3rd codon in this mRNA? What is the sequence of the last codon in this mRNA that actually code for an amino acid?arrow_forwardGive typing answer with explanation and conclusion Which of the following statements regarding the structure and function of tRNA is true? A-The codon / anticodon pairing is absolutely universal among organism. B-The charging of a tRNA does not require energy. C-There are 64 different tRNAs, one for each possible codon. D-Reading 5' to 3', the first base in the anticodon can participate in non Watson and Crick base pairing E- The 3' end of each tRNA has a unique sequence so a specific amino acid can be attached.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY