Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 9P
The results shown in Fig. 8.5 may have struck you as incongruous because many synthetic RNAs that lacked AUG start codons (such as poly-U) were nonetheless translated into polypeptides in vitro. The reason this experiment was possible is that Marshall Nierenberg found that a high concentration of Mg2+ ions in the test tube, much higher than that found in cells, allows ribosomes to initiate translation at any position on an RNA molecule. Predict the outcomes of in vitro translation with each of the following synthetic mRNAs at both high and low Mg2+ concentrations:
| a. | poly-UG (UGUGUG...) |
| b. | poly-CAUG (CAUGCAUGCAUG...) |
| c. | poly-GUAU (GUAUGUAUGUAU...) |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'.
What is the sequence of the partner strand?
If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
A mutant strain of Salmonella bacteria carries a mutation of the rho protein that has fully activity at 37°C but is completely inactivated when the mutant strain is grown at 40°C.
a)Speculate about the kind of differences you would expect to see if you compared a broad spectrum of mRNAs from the mutant strain grown at 37°C and the same spectrum of mRNAs from the strain when grown at 40°C.
b)Are all the mRNAs affected by the rho protein mutation in the same way? Why or why not?
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region.
5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^
Which strand is the template strand for transcription of this gene? Briefly explain how you know.
An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur?
A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
Chapter 8 Solutions
Genetics: From Genes to Genomes
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?arrow_forwardAlthough the genetic code is universal, a few organisms such as Paramecium have a slightly modified version in which UGA, a stop codon for most organisms, codes for tryptophan in Paramecium. Suppose that the researcher wanted to make an in vitro translation system using all of the components from Paramecium. Which of the components, if any, would she need to replace in order to have an in vitro system that was universal? Possible Answers: A. She would need to leave out the P site. B. She would need to leave out the termination factor proteins. C. She would need to leave out the tRNA that recognizes UGA. D. She would need to leave out the ubiquitinarrow_forwardWhen a region of DNA that contains the genetic information for a protein is isolated from a bacterial cell and inserted into a eukaryotic cell in a proper position between a promoter and a terminator, the resulting cell usually produces the correct protein. But when the experiment is done in the reverse direction (eukaryotic DNA into a bacterial cell), the correct protein is often not produced. Can you suggest an explanation?arrow_forward
- In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.arrow_forwardThe following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?arrow_forwardWhen an EcoR1 fragment, which represents the coding region of a human gene X, is cloned into the EcoR1 site upstream of the coding region of a prokaryotic gene (such as GST) (i.e., to make a X-GST fusion protein), what is the chance of an in-frame fusion? Please draw a diagram to explain your answer. Do you need to delete the stop codon of the X gene coding region before fusing it to the GST coding region? Please draw a diagram to explain your answer. Notes: It is NOT known which strand of the human gene X is the template strand for transcription. 2) Both X and GST protein fragments must be produced correctly)arrow_forward
- You start by looking at the mutations that Yanofsky recovered in TrpA. One of these mutations affected amino acid number 177 and changed it from Leucine to Arginine – because Yanofsky recovered it in his screen, that means that having an Arginine in this position does not allow the TrpA gene to function properly. Assuming that this particular mutation induced by Yanofsky was a single nucleotide change, what are the possible codons of Leucine that could be found at this position in wild-type TrpA? What are the possible codons for Leucine that could be found in the mutant?. If you took this mutant E. Coli line (that has an Arginine at this location) and exposed it to a mutagen that could potentially change bases, what are the second mutations you would most likely discover that would restore the activity of the tryptophan synthetase gene and where would it be located?arrow_forwardYou start by looking at the mutations that Yanofsky recovered in TrpA. One of these mutations affected amino acid number 177 and changed it from Leucine to Arginine – because Yanofsky recovered it in his screen, that means that having an Arginine in this position does not allow the TrpA gene to function properly. Assuming that this particular mutation induced by Yanofsky was a single nucleotide change, what are the possible codons of Leucine that could be found at this position in wild-type TrpA? What are the possible codons for Leucine that could be found in the mutant?arrow_forwardWhat molecular biology strategy can best be used to determine Inhibition of the splicing of one intron from the parental RNA resulting in a longer protein product? Explain.arrow_forward
- A mutation is found in a tRNA-encoding gene. The wild type (non-mutant) allele (version) produces a tRNA that recognizes the codon GAA, and is charged with the amino acid glutamic acid (Glu). The mutant tRNA is still charged with Glu, but it recognizes the codon UAA. What effect will this have on translation in these cells? How will the proteins produced be different? Speculate: is this mutation more likely to be beneficial or harmful?arrow_forwardThe flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a diff erent C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.arrow_forwardThe interphase nucleus is a highly structured organelle with chromosome territories, interchromatin compartments, and transcription factories. In cultured human cells, researchers have identified approximately 8000 transcription factories per cell, each containing an average of eight tightly associated RNAP II molecules actively transcribing RNA. If each RNAP II molecule is transcribing a different gene, how might such a transcription factory appear? Provide a simple diagram that shows eight different genes being transcribed in a transcription factory and include the promoters, structural genes, and nascent transcripts in your presentation.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license