Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 32P
The yeast gene encoding a protein found in the mitotic spindle was cloned by a laboratory studying mitosis. The gene encodes a protein of 477 amino acids.
| a. | What is the minimum length in |
| b. | A partial sequence of one DNA strand in an exon containing the middle of the coding region of the yeast gene is given here. What is the sequence of nucleotides of the mRNA in this region of the gene? Show the 5′and 3′ directionality of your strand. 5′ GTAAGTTAACTTTCGACTAGTCCAGGGT 3′ |
| c. | What is the sequence of amino acids in this part of the yeast mitotic spindle protein? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence:
3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'.
What is the sequence of the partner strand?
4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
4C. In NOT more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus?
The following figure shows a screen shot from the UCSC Genome Browser, focusing on a region of the human genome encoding a gene called MFAP3L. (Note hg38 refers to version 38 of the human genome RefSeq)a. Describe in approximate terms the genomic location of MFAP3L.b. Is the gene transcribed in the direction from the centromere-to-telomere or from the telomere-to-centromere?c. How many alternative splice forms of MFAP3L mRNA are indicated by the data?d. How many different promoters for MFAP3L are suggested by the data?
The following figure shows a screen shot from the UCSC Genome Browser, focusing on a region of the human genome encoding a gene called MFAP3L. (Note hg38 refers to version 38 of the human genome RefSeq)a. Describe in approximate terms the genomic location of MFAP3L.b. Is the gene transcribed in the direction from the centromere-to-telomere or from the telomere-to-centromere?c. How many alternative splice forms of MFAP3L mRNA are indicated by the data?d. How many different promoters for MFAP3L are suggested by the data?
(please do not copy and paste the answer from below. i don't think it is correct.
a. MFAP3L is mostly found in the nucleus in the genome. It is found on chromosome 4 reverse strand. The protein produced by the gene is found in the cell membrane, and it is positioned on the membrane with the carboxyl side of the protein facing the cytosol.
b. The MFAP3L gene is transcribed from the telomere to the centromere.
c. According to the data, there are 11 different splice forms…
Chapter 8 Solutions
Genetics: From Genes to Genomes
Ch. 8 - For each of the terms in the left column, choose...Ch. 8 - Match the hypothesis from the left column to the...Ch. 8 - How would the artificial mRNA 5GUGUGUGU . . . 3 be...Ch. 8 - An example of a portion of the T4 rIIB gene in...Ch. 8 - Consider Crick and Brenners experiments in Fig....Ch. 8 - The HbSsickle-cell allele of the human -globin...Ch. 8 - The following diagram describes the mRNA sequence...Ch. 8 - The amino acid sequence of part of a protein has...Ch. 8 - The results shown in Fig. 8.5 may have struck you...Ch. 8 - Identify all the amino acid-specifying codons in...
Ch. 8 - Before the technology existed to synthesize RNA...Ch. 8 - A particular protein has the amino acid sequence...Ch. 8 - How many possible open reading frames frames...Ch. 8 - Prob. 14PCh. 8 - Charles Yanofsky isolated many different trpA-...Ch. 8 - The sequence of a segment of mRNA, beginning with...Ch. 8 - You identify a proflavin-generated allele of a...Ch. 8 - Using recombinant DNA techniques which will be...Ch. 8 - Describe the steps in transcription that require...Ch. 8 - Chapters 6 and 7 explained that mistakes made by...Ch. 8 - The coding sequence for gene F is read from left...Ch. 8 - If you mixed the mRNA of a human gene with the...Ch. 8 - Prob. 23PCh. 8 - The Drosophila gene Dscam1 encodes proteins on the...Ch. 8 - Describe the steps in translation that require...Ch. 8 - Locate as accurately as possible the listed items...Ch. 8 - Concerning the figure for Problem 26: a. Which...Ch. 8 - a. Can a tRNA exist that has the anticodon...Ch. 8 - For parts a and b of Problem 28, consider the DNA...Ch. 8 - Remembering that the wobble base of the tRNA is...Ch. 8 - Prob. 31PCh. 8 - The yeast gene encoding a protein found in the...Ch. 8 - The sequence of a complete eukaryotic gene...Ch. 8 - Arrange the following list of eukaryotic gene...Ch. 8 - Prob. 35PCh. 8 - The human gene for 2 lens crystallin has the...Ch. 8 - In prokaryotes, a search for genes in a DNA...Ch. 8 - a. The genetic code table shown in Fig. 8.2...Ch. 8 - a. Very few if any eukaryotic genes contain tracts...Ch. 8 - Explain how differences in the initiation of...Ch. 8 - Do you think each of the following types of...Ch. 8 - Null mutations are valuable genetic resources...Ch. 8 - The following is a list of mutations that have...Ch. 8 - Considering further the mutations described in...Ch. 8 - Adermatoglyphia described previously in Problem 18...Ch. 8 - Prob. 46PCh. 8 - You learned in Problem 21 in Chapter 7 that the...Ch. 8 - When 1 million cells of a culture of haploid yeast...Ch. 8 - Why is a nonsense suppressor tRNATyr, even though...Ch. 8 - A mutant B. adonis bacterium has a nonsense...Ch. 8 - You are studying mutations in a bacterial gene...Ch. 8 - Another class of suppressor mutations, not...Ch. 8 - Yet another class of suppressor mutations not...Ch. 8 - At least one nonsense suppressing tRNA is known...Ch. 8 - An investigator was interested in studying UAG...Ch. 8 - Prob. 56PCh. 8 - In certain bacterial species, pyrrolysine Pyl,...Ch. 8 - Canavanine is an amino acid similar to arginine...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The following figure shows a screen shot from the UCSC Genome Browser, focusing on a region of the human genome encoding a gene called MFAP3L. (Note hg38 refers to version 38 of the human genome RefSeq) a. Describe in approximate terms the genomic location of MFAP3L. b. Is the gene transcribed in the direction from the centromere-to-telomere or from the telomere-to-centromere? c. How many alternative splice forms of MFAP3L mRNA are indicated by the data? d. How many different promoters for MFAP3L are suggested by the data?arrow_forwardExpression of recombinant proteins in yeast is an important tool for biotechnology companies that produce new drugs for human use. In an attempt to get a new gene X expressed in yeast, a researcher has integrated gene X into the yeast genome near a telomere. Will this strategy result in good expression of gene X? Why or why not? Would the outcome of this experiment differ if the experiment had been performed in a yeast line containing mutations in the H3 or H4 histone tails?arrow_forwardThe E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition sequence for the trp repressor would be expected to occur in the E. coli chromosome? (b) Explain why it is advantageous for the trp repressor to be a dimer that recognizes two adjacent 6-bp sequences.arrow_forward
- A plant geneticist was examining the inversion mutation XI 501 in barley where a segment of DNA is removed, flipped, and reinserted in reverse order. The original protein functioned to assist in the separation of daughter cells during meiosis. A model of the initiation of normal protein translation is shown in the diagram. The action of the mutation is shown in orange. Using the model, which of the following predicts how the XI 501 mutation affects the protein produced? A - It creates a protein with the order of amino acids reversed, causing the protein to fold backward, reducing pollen functionality. B - It creates a nonsense protein that does not function in the cell, causing the cell to use energy to remove the proteins, reducing pollen fertility. C - It creates a protein that terminates at the mutation, causing the pollen to carry more than one copy of the genetic material in each granule. D - It creates a protein with half the amino acids correct and half reversed, reducing…arrow_forwardMutations in the CFTR gene result in cystic fibrosis in humans, a conditions in which abnormal secretions are present in the lungs, pancreas, and sweat glands. The gene was mapped to a 500-kb region on chromosome 7 containing 3 candidate genes. a)Using your knowledge of the disease symptoms, how would you distinguish between the candidate genes to decide which is most likely to encode the CFTR gene? b)How would you prove that your chosen candidate is the CFTR gene?arrow_forwardin the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.arrow_forward
- You are studying a small eukaryotic gene of about 2000 bp in length. About how many copies of histone H4 would you expect to find along this region of the chromosome?arrow_forwardThe coding sequences of Gene F and Gene G are shown by the double-stranded DNA below. Using the genetic code, what is the polypeptide chain sequence when Gene G is completely expressed?arrow_forwardTo identify the following types of genetic occurrences, would acomputer program use sequence recognition, pattern recognition,or both?A. Whether a segment of Drosophila DNA contains a P element(which is a specific type of transposable element)B. Whether a segment of DNA contains a stop codonC. In a comparison of two DNA segments, whether there is aninversion in one segment compared with the other segmentD. Whether a long segment of bacterial DNA contains one ormore genesarrow_forward
- Lysine 4 of histone H3 (H3K4) is methylated in thenucleosomes of many transcriptionally active genes.Suppose you want to determine all the places in thehuman genome where nucleosomes contain methylated H3K4.a. Starting with an antibody that specifically bindsonly to the tails of histone H3s that have K4 methylation, what kind of experiment would you perform? Outline the major steps of this experiment.b. Do you think that you would get the same results ifyour starting material was skin cells in one experiment and blood precursor cells in a second experiment? Explain.c. Describe a follow-up experiment that could determine if your data from part (a) are consistent withthe idea that H3K4 methylation marks appear onlyat transcriptionally active genesarrow_forwardHere is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases will the pre mRNA transcript be? Explain briefly. What is the maximum number of amino acids that could make up the protein product from the final mRNA? Explain briefly.arrow_forwardWhat are the functions of transcriptional activator proteins and repressor proteins? Explain how they work at the molecular level.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY