To answer: Antisense RNA used to terminate translation of TACAATCGCATTGAA sequence. Introduction: In translation, m-RNA is converted into amino acid sequences, resulting in protein synthesis. Three important components are involved in translation are m-RNA, t-RNA, and the ribosome. Protein synthesis occurs in the cytoplasm of the cell. The mRNA sequence encoded by the genetic material is translated into a specific protein. The t-RNA binds to free amino acids and transfer them to the ribosome and the amino acids are added to the growing chain of the protein sequence. The ribosome reads m-RNA and synthesizes protein based on codons present in the m-RNA sequence. The ribosome binds to the anticodon of particular tRNA according to m-RNA sequence and assembles amino acids corresponding to mRNA codons. Three nucleotides of m-RNA sequence code for a single amino acid of the protein sequence is known as a codon. The twenty amino acids are represented by a different pattern of four nitrogenous bases is called as the genetic code. Sixty four (64) codons (different pattern of three nucleotides) encode 20 amino acids. Protein synthesis occurs in three steps which are initiation, elongation, and termination. AUG is the start codon, which initiates protein synthesis from m-RNA sequence, whereas, UAG, UGA, and UAA are stop codons which terminate protein synthesis.

Question

Want to see the full answer?

Answer 1

Question

Chapter 8, Problem 7CT

Summary Introduction

To answer:

Antisense RNA used to terminate translation of TACAATCGCATTGAA sequence.

Introduction:

In translation, m-RNA is converted into amino acid sequences, resulting in protein synthesis. Three important components are involved in translation are m-RNA, t-RNA, and the ribosome. Protein synthesis occurs in the cytoplasm of the cell. The mRNA sequence encoded by the genetic material is translated into a specific protein. The t-RNA binds to free amino acids and transfer them to the ribosome and the amino acids are added to the growing chain of the protein sequence. The ribosome reads m-RNA and synthesizes protein based on codons present in the m-RNA sequence. The ribosome binds to the anticodon of particular tRNA according to m-RNA sequence and assembles amino acids corresponding to mRNA codons. Three nucleotides of m-RNA sequence code for a single amino acid of the protein sequence is known as a codon. The twenty amino acids are represented by a different pattern of four nitrogenous bases is called as the genetic code. Sixty four (64) codons (different pattern of three nucleotides) encode 20 amino acids. Protein synthesis occurs in three steps which are initiation, elongation, and termination. AUG is the start codon, which initiates protein synthesis from m-RNA sequence, whereas, UAG, UGA, and UAA are stop codons which terminate protein synthesis.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Several common antibiotics affect some strains of bacteria's ability to carry out transcription and/or translation. For example: Rifamycin inhibits prokaryotic RNA polymerase Chloramphenicol blocks the transfer of the peptide from the P to A site. a) For each of these drugs, identify at what point it could affect the process of DNA->RNA->protein. Be as specific as possible. b) Why do you think these drugs kill bacteria but spare animal cells? (Hint: remember bacteria are prokaryotes)

The following sequence is from a region of the M13 bacteriophage genome. Identify and label the promoter elements that would be recognized by the bacterial RNA polymerase. Where would transcription begin? CAGGCGATGATCAAATCTCCGTTGTACTTTGTTTCGCGCGTTGGTATAATCGCTGGGGTCAAGATGAGT

The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA as a template strand for transcription, you are required to synthesize a new RNA strand. A) Show the codons that will be present on the RNA strand. B) Using the universal genetic code, provide the amino acids on the protein that will be translated from the RNA strand. 3’ TAC ATG GTT GTG CTA ATT 5’