Concept explainers
To answer:
The number of DNA molecules synthesized in PCR reaction using 15 DNA helices in 15 cycles.
Introduction:
PCR technique is a rapid method used to amplify the huge amount of a specific segment of the DNA molecule. It is used to generate a billion copies of identical molecules of the DNA segment within few hours. It is used to analyze genomic variation and mainly involved in clinical studies. The important components used for PCR reactions are DNA, primer, deoxyribonucleotide triphosphates (A, T, G, and C) or dNTPs, Taq DNA polymerase, MgCl2, and buffer. There are nearly 30 cycles are involved in PCR to produce numerous copies of exact replicas.
The main steps of PCR in each cycle:
Denaturation: Separation of double-stranded DNA into two single-strand DNA molecules by cleaving the hydrogen bonds at 94°C.
Annealing: Binding of primers (20 - 30
Extension: Addition of dNTPs at 3’ site of the primer by DNA polymerase to synthesize complementary stand of ssDNA at 72°C.
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 8 Solutions
EBK MICROBIOLOGY:W/DISEASES BY BODY...-
- During PCR, the reaction mixture cycles through three temperatures (for example 94, 60, and 72 degrees Celsius) multiple times. What happens during the 94 degree part of a cycle? Group of answer choices Double-stranded DNA denatures and becomes single-stranded. DNA polymerase synthesizes daughter DNA molecules. An oligonucleotide primer anneals to a template DNA strand.arrow_forwardTo amplify a section of DNA using the polymerase chain reaction (PCR), all you need to load into the tube is 1) a buffer solution, 2) the DNA you want to amplify, 3) some DNA nucleotides, 4) a polymerase (like Taq polymerase), and O an RNA polymerase a set of forward and reverse primers some phospholipids for a cell membrane some ribosomesarrow_forwardThe image below shows the replication bubble of a piece of DNA in the process of replication. However, the image only shows the DNA strands being replicated. Fill in the rest of the elements of the figure, specifically: primers, Okazaki fragments, newly replicated leading strand DNA, as well as the enzymes helicases, primase, DNA polymerase III, DNA polymerase I, and ligase. Also, be sure to indicate the 5' and 3' ends of all nucleic acid polymers.arrow_forward
- Order the steps required to sequence a region of DNA using dideoxy sequencing. Amplify the region of DNA to be sequenced add a primer, deoxynucleotides, labeled dideoxynucleotides, and DNA polymerase a primer binds to the single-stranded DNA template DNA polymerase extends the primer, incorporating deoxynucleotides a labeled dideoxynucleotide terminates the growing DNA chain gel electrophoresis separates the mixture of DNA fragments by size The DNA sequence is determined denature the double-stranded DNA Answer Bankarrow_forwardcompare and contrast DNA replication in the cell with PCR-based replication in the lab. Do these two processes use the same number of proteins, why or why not? What reagents are added to a PCR reaction and are the primers used in both made of the same material? What about the requirements of the replication fork, same or different?arrow_forwardThe image below shows the replication bubble of a piece of DNA in the process of replication. However, the image only shows the DNA strands being replicated. Fill in the rest of the elements of the figure, specifically: primers, Okazaki fragments, newly replicated leading strand DNA, as well as the enzymes helicase, primase, DNA polymerase III, DNA polymerase I and ligase. Also be sure to indicate the 5’ and 3’ ends of all nucleic acid polymers.arrow_forward
- See the restriction enzyme map below. The total DNA length is 1800 base pairs. If this DNA is cut using three restriction enzymes, namely Kpnl, Sall and EcoRI, it yields four fragments with sizes of 390 bR. 810 bp, 270 bp www and 330 bp. Kpnl Sall EcoRI 390 810 270 330 1800 bp 1. If you were to subject this digested DNA to agarose gel electrophoresis, what would your gel look like? Draw a detailed picture of your gel. Remember to indicate the direction in which your DNA is moving and also show any reference samples. Also remember to show all components of your gel. 2. You are provided with coiled DNA and plasmid DNA that you subject to gel electrophoresis. Draw this gel. Remember to indicate the direction in which your DNA is moving and also show any reference samples. Also remember to show all components of your gel. Exac fragment sizes are not important.arrow_forwardIf you were to set up a PCR reaction (in vitro DNA synthesis) with a DNA template, primers,DNA polymerase, DATP, dGTP, dCTP, dTTP and a small amount of ddATP, what would be the result? DNA synthesis would happen normally. All DNA molecules produced would be the same length as the template. DNA synthesis might be terminated after the addition of any adenine base (at random). DNA molecules of many different lengths would be produced. DNA synthesis would be terminated after the first adenine base is added. All DNA molecules produced would the same length, shorter than the template.arrow_forwardDuring agarose gel electrophoresis, why does DNA move through the gel when electric current is applied? because DNA is negatively charged because a charged chemical from the loading buffer is bound to the DNA because DNA is positively charged because DNA absorbs electricityarrow_forward
- PCR primers Below is a 300 base pair fragment of DNA. The top strand is written in the 5' to 3' direction. The bottom strand is written 3' to 5'. There are also two primer sequences; both primers are written 5' to 3'. Note that we are displaying a double-stranded DNA fragment, but primers will only bind to one of the two displayed strands. 5' ACCGȚAGCTATATGCTATCGTGACGTATCGGCGCATTAAȚCGGGATCGAT 3 50 3' TGGCÁTCGATATACOATAGCACTOCATAGCCGCGTAATTÀGCCCTAGCTÀ 5' 5' AGCTÇGCTAGCAGGAGAGAȚATCGÇTCATAGCTCCGATCGATGCCGCTAA 3 3' TCGAGCG ATCGTCCTCTCTÁTAGCGAGTATCGAGÓCTAGCTACGGCGATİ 5' 100 5' TATAGCTCTÇTGCGGATATÇGCATATACCẠ AGGCCCTACGTATGTAGCTA 3 150 3' ATATČGAGAGACOCCTATAGCGTATATGGTTCCGGGATGČATACATCGAŤ 5' 5 TGCGTATATÇGGAGAGTCCTGGATATGGAGCTTGACTGCAGAGAGCTCGA 3 200 3' ACGCÁTATAGCCTCICAGGÁCCTATACCTCGAACTGACGTCTCTCGAGCT 5' 5' TATGCGCTTAGGCCGTATATGCTTGGGGAAAGCTCTATGTATGCTATGTG 3 3. ATACGCGAATCCGGCATATACGAACCCCTÍTCGAGATACATACGATACAC 5' 250 5' TGCATGTGCTATGCAACGTTCOGATTGCGȚAGCAGTAATAGCGCCGATTG 3 300 3'…arrow_forwardThe way that PCR amplifi es DNA is similar to the doubling in a population of growing bacteria; a single DNA strand is used to synthesize 2 DNA strands, which become 4, then 8, then 16, etc. If a complete cycle takes 3 minutes, how many strands of DNA would theoretically be present after 10 minutes? After 1 hour?arrow_forwardWhich of the following steps is NOT part of a typical polymerase chain reaction? Choose an answer below: primer annealing ligation of DNA fragments by DNA ligase primer extension by DNA polymerase heat denaturation of double stranded DNA none of the abovearrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)