Concept explainers
To answer:
Recognition and restriction of DNA sequence by HhaI.
Introduction:
Restriction enzymes recognize and cut DNA
Want to see the full answer?
Check out a sample textbook solutionChapter 8 Solutions
EBK MICROBIOLOGY:W/DISEASES BY BODY...-
- This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.arrow_forwardList the sequences of RNA that would be transcribed from the following DNA template sequences. TTACACTTGCTTGAGAGTC ACTTGGGCTATGCTCATTA GGCTGCAATAGCCGTAGAT GGAATACGTCTAGCTAGCAarrow_forwardDirect repair of pyrimidine dimer formation in E. Coli can be accomplished by nucleotide excision. true or false?arrow_forward
- A DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide Lengtharrow_forwardProvide the sequences of the template and coding strands of a DNA double helix that was used to produce this RNA: 5'-AUUACGGUCUAU. Be sure to label the 5' and 3' ends.arrow_forwardIdentify the dinucleotide CA repeat region and the score in the following sequence:TGGCACACTCACACCACACAGACAGTTAarrow_forward
- The enzyme dihydrofolate oxidase has 3 adjacent asparagines residues (codon for asparagines is ACC): explain how site directed mutagenesis could be used to increase the thermal stability of the proteinarrow_forwardYou are studying a protein that contains the peptide sequence RDGSWKLVI. The part of the DNA encoding this peptide is included in the sequence shown below. 5'-CGTGACGGCTCGTGGAAGCTAGTCATC-3' 3'-GCACTGCCGAGCACCTTCGATCAGTAG-5' This sequence does not contain any BamHI restriction enzyme sites. The target sequence for the BamHI restriction nuclease is GGATCC. Your goal is to create a BamHI site on this plasmid by manipulating the DNA sequence, without changing the coding sequence of the protein. How would you do this, ie what would the new sequence be?arrow_forwardIntroduction: The enzyme deoxyribonuclease I (DNase I) is an endonuclease that hydrolyzes the phosphodiester bonds of the double-stranded DNA backbone to yield small oligonucleotide fragments. DNase I is used therapeutically to treat patients with cystic fibrosis (CF). The DNase I enzyme is inhaled into the lungs where it then acts upon the DNA contained in the viscous sputum secreted by the lungs in these patients. Hydrolysis of high molecular weight DNA to low molecular weight DNA in the sputum decreases its viscosity and improves lung function. Animal studies have shown that DNase I is also effective in treating the autoimmune disease systemic lupus erythematosus (SLE). In this disease, the DNA secreted into the serum provokes an immune response. DNase I prevents the immune response by degrading the DNA to smaller fragments that are not recognized by the immune system. Genentech, Inc., the company that produces the recombinant DNase I, was interested in improving the efficiency of…arrow_forward
- Introduction: The enzyme deoxyribonuclease I (DNase I) is an endonuclease that hydrolyzes the phosphodiester bonds of the double-stranded DNA backbone to yield small oligonucleotide fragments. DNase I is used therapeutically to treat patients with cystic fibrosis (CF). The DNase I enzyme is inhaled into the lungs where it then acts upon the DNA contained in the viscous sputum secreted by the lungs in these patients. Hydrolysis of high molecular weight DNA to low molecular weight DNA in the sputum decreases its viscosity and improves lung function. Animal studies have shown that DNase I is also effective in treating the autoimmune disease systemic lupus erythematosus (SLE). In this disease, the DNA secreted into the serum provokes an immune response. DNase I prevents the immune response by degrading the DNA to smaller fragments that are not recognized by the immune system. Genentech, Inc., the company that produces the recombinant DNase I, was interested in improving the efficiency of…arrow_forwardThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: bottom strand is the noncoding strand). 5'-ААCGCATGAGAAAGCCCCCCGGAAGATCACСТТСCGGGGGCТТТАТАТААТТАGC-3' 3'-тTGCGTACтстттCGGGGGGCCTTCTAGTGGAAGGCCCCCGАААТАТАТТААТтCG-5' (i) Draw the structure of hairpin loop that will be formed during transcription. (ii) Illustrate how the hairpin loop structure initiates the termination of transcription.arrow_forwardTranslate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’arrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning