2. The telomeric sequence in a species is (5-AACGGT-3'), repeats. You design a FISH experiment with the probe 5-AACGGTAACGGTAACGGTAACGGT-3. Which of the following illustrates the expected image of a metacentric chromosome (the dark region indicates fluorescence)? a. C. XX X e. d.
Q: 3. Now that the sequence of the entire E. coli K12 straingenome (roughly 5 Mb) is known, you can…
A: The complete genome of E.coli is 5.44 million base pairs. The genome is replicated entirely in one…
Q: 2. Scientists now routinely use CRISPR/Cas9 to makedefined deletions of a gene that can remove…
A: Nowadays, scientists are using CRISPR/Cas9 for making necessary deletions in the genome of the…
Q: 1. Why do you think SNPS are more commonly found in intergenic regions ? a.Because intergenic…
A: Single nucleotide polymorphism (SNP) is the change in the single nucleotide through addition or…
Q: 5. You imagine that not all life forms (including viruses and aliens) must have double stranded DNA…
A: a.The genome is double stranded RNA. Since, there is no thymine (T) in the genome and there is…
Q: 4. Some transposases use extensive DNA replication to leave one copy of the element behind in a…
A: Trnasposases are the enzymes that identify the inverse terminal repeat sequences within the DNA and…
Q: Which of the following alternative steps cannot be employed in the DNA extraction because it would…
A: You have asked multiple questions. I will answer 1st question, as allowed by guidelines. Asked :…
Q: 1. Let s and s' be two sequences, where s= GGATT and s' evolves from s by substituting the A in s by…
A: The DNA is present in a double helix sequence, which has two strands present in complementary to…
Q: 1. The definition of a gene is: a. the sum of genetic information in an organism b. a segment of…
A: Defination of the gene :-
Q: 4. Assume that a new low-calorie sweetener is developed. The structure is novel and is tested with…
A: Any product that is intended for human consumption requires prior approval and usage recommendation…
Q: please only answer parts d and e and f
A: To figure out which baby goes to each set of parents it is decided to perform PCR as there are three…
Q: 1 What pairs with A? 2. What pairs with C? 3. DNA is semi-conservative. Why is this an efficient and…
A: The DNA (deoxyribonucleic acid) is the hereditary material of an organism. The DNA is a part of the…
Q: 4. Give the importance of Genomics especially in human. What are the different techniques in…
A: A genome is an organism's whole collection of DNA. The genomic DNA sequence is held within an…
Q: what is A structure composed of DNA and associated proteins that in total contain the genome of an…
A: Nucleus is a double membrane bound dense protoplasmic body which controls all cellular metabolism…
Q: 1. To study or edit a single gene, scientists must first isolate it from the rest of the genes in a…
A: DNA has gone from being the most challenging macro-molecule in the cell to being the simplest. It is…
Q: 1. Which of the following terns refers to both the movement of a ribosome along a piece of MRNA and…
A: A karyotype test examines the size, structure, and amount of chromosomes in your body. The sections…
Q: 5. The downstream process for a recombinant protein begins with 100 liters of clarified lysate. At…
A: Protein purification is series of processes to isolate one or few proteins from a complex mixture of…
Q: A molecular biologist is investigating homologous recombination. One aim of this study is to…
A: Note - we answer one question at a time. Homologous recombination is a kind of genetic…
Q: The complementary strands of DNA in the double helixare held together by hydrogen bonds: G ≡ C or A…
A: DNA double helix is formed by the hydrogen bonds formed between the base pairs. Adenines forms two…
Q: A molecular biologist is investigating homologous recombination. One aim of this study is to…
A: Holliday junction is a four-strand DNA nucleotide strand that is formed during genetic…
Q: he DNA of each species has a different base composition. Find the base composition of each species,…
A: Introduction Adenine, Guanine, Thymine, and Cytosine are the only nucleotides that may exist in DNA;…
Q: 4. The bars in the following sequence indicate the breakpoints of a deletion.…
A: The given sequence has bars indicating the breakpoint of a deletion means we are going to delete the…
Q: . A haplotype is a specific set of SNPs and other genetic variants observed on a single chromosome…
A: DNA can be defined as the type of nucleic acid which is made from deoxyribose sugar along with four…
Q: What does the salt in the soapy salt solution do in the DNA extraction? a. It dissolves the DNA. b.…
A: DNA molecule is a negatively charged molecule which is made up of nucleotides. Each nucleotide is…
Q: 3. A long DNA will be divided into small fragments, and one of them will be attached to the bead and…
A: Ion torrent sequencing is the method of sequencing by signals of pH change voltage generation, which…
Q: 1. What is the role of salt and dishwashing liquid in the extraction/isolation of DNA from yeast and…
A: "DNA extraction or DNA isolation" is a procedure or a method wherein DNA is purified by physical…
Q: What can you conclude about the base composition and base distribution of G-C base pairs in the…
A: DNA has a density which is weight divided by volume of about 1.7 grams per cubic centimeter (1.7 g…
Q: 2. A. B. C. The DNA of each species has a different base composition. Find the base composition of…
A: Nucleotide subunits made up DNA's structure. Deoxyribose along with a phosphate group, and one of…
Q: Lampbrush and polytene chromosomes are characteristic because of the fact that A. nucleosomes are…
A: Lampbrush and polytene chromosomes are also called as the giant chromosome because of its large size…
Q: 3. After analyzing a DNA sequence for gene properties, the following sequences were reported at the…
A: Introduction : Genetic Codon: The Genetic Code Is A System Of Rules That Live Cells Employ To…
Q: 4. A recent estimate of the rate of base substitutions atSNP loci is about 1 × 10−8 per nucleotide…
A: Base substitution is the simplest type of gene mutation that involves the swapping of one nucleotide…
Q: 3. For each of the following characteristics, list all of the bases (A, B, C, or D) to which they…
A: A molecule that consists of Nitrogen and possess the chemical property of a base, is known as a…
Q: 4. The following distance matrix was provided for five nucleotide sequences. A D A 8 7 12 15 10 9.…
A:
Q: 1. Genome annotation refers to all of the following except a. assigning a unique identifier given…
A: 1. Genome annotation refers to all of the following except Answer: e. All of the above are correct…
Q: 2. What will most likely happen if there is a change in the base sequence of this molecule? a. The…
A: During DNA replication, mutations can occur if mistakes are made and not corrected in time.…
Q: 3) Erwin Chargaff is considered one of the pioneering scientists in the field of molecular biology.…
A: According to the Chargaff’s Rule, DNA consists of nucleotides and contains nitrogen bases (Adenine,…
Q: 1. Illustrate. Consider the given pair of homologous DNA molecules. W X Y W' X' Y' w' x' W X y Z…
A: A Holliday junction is a nucleic acid structure with four double-stranded arms that are linked…
Q: 7. Why recombinant DNA is very useful in improving our health conditions? A. Human insulin can be…
A: Of the many advancements in biotechnology, invention of rDNA technology is most significant because…
Q: 8. After a gene duplication occurs, the resulting genes will accumulate different mutations, thereby…
A: The globins represent a superfamily that includes globular proteins. These proteins are involved in…
Q: In DNA-hybridization experiments on six species of plants in the genus Vicia, DNA was isolated from…
A: In 1968. Kohne and Britten carried out the renaturation kinetics of DNA, wherein the DNA under the…
Q: The simplest mobile elements in bacteria are called ___________________. A. insertion sequences B.…
A: Introduction A plasmid is a short extrachromosomal DNA molecule that can replicate independently of…
Q: 1) Using the diagram below, sketch in the pattern of bands you would expect to see after digesting…
A: TAS2R38 is a taste receptor gene present in the 7th chromosome of the genome. The length of a gene…
Q: 3. The data in the following table represent the base composition of two double stranded DNA sources…
A: Ervin Chargaff discovered the Base proportion in double stranded DNA. The findings in his study came…
Q: What proportion in the human genome are actual genes? 2. What are tandem repeats?
A: Introduction All of an organism's genetic data is included in its genome. It is made up of DNA…
Q: 4. You can carry out matings between an Hfr and F−strain by mixing the two cell types in a small…
A: Bacterial conjugation is a process through which the DNA is transferred from the living cell into…
Q: If we figured out the amino acid sequence of a peptide, could we use that information to find the…
A: Within an interbreeding population, a gene pool is a set of different genes. The term gene pool…
Q: 6. You perform a high throughput DNA sequencing reaction on chromosome number 1 from a newly…
A: a)Arranging the fragments with overlapping sequences on the fragments ends. 2.GGCTATTTCGCCG 4.…
Q: 5. In the late 1950s, Meselson and Stahl grew bacteria in a medium containing "heavy" nitrogen (15N)…
A: DNA is the genetic material in most living organisms and is the information hub of the cell. It…
Q: 4. Evolutionary change due to mutation, resulting from an altered nucleotide sequence (in a cell or…
A: Properties of genetic material Replication, It should be able to generate it's replica It should…
Q: 1. Transcribe the DNA strand provided then determine the sequence of amino acids of the gene…
A:
Q: 1. How does site specific recombination differ from homologous recombination? a. It requires a…
A: How does site specific recombination differ from homologous recombination Answer : a. It requires a…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Explain how DNA probes with different fluorescence emissionwavelengths can be used in a single FISH experiment to map thelocations of two or more genes. This method is called chromosomepainting. Explain why this is an appropriate term.A molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’A technique called fluorescence in situ hybridization (FISH) is described. In this method, a labeled piece of DNA is hybridized to a set of chromosomes. Let’s suppose that you cloned a piece of DNA from G. pubescens and used it as a labeled probe for in situ hybridization. What would you expect to happen if this DNA probe were hybridized to the G. speciosa or G. tetrahit chromosomes? Describe the expected results.
- Lampbrush and polytene chromosomes are characteristic because of the fact that A. nucleosomes are 3-dimensionally distinct from "normal" chromosomes B. microscopy shows they have regions with loosely bound DNA near tightly bound regions C. multiple centromeres were discovered on their linear sequence by in situ hybridization D. DNAse is unable to cleave the linkage between strandMatch each of the terms in the left column to the bestfitting phrase from the right column.a. exome 1. a discrete part of a protein that provides a unitof functionb. de novo gene 2. a nonfunctional member of a gene familyc. gene desert 3. the joining together of exons in a gene indifferent combinationsd. pseudogene 4. most frequent residues, either nucleotide oramino acid, found at each position in asequence alignmente. syntenic block 5. set of genes related by processes ofduplication and divergencef. orthologs 6. chromosomal region with the same genes inthe same order in two different speciesg. naturalselection7. genes with sequence similarities in twodifferent species that arose from a commonancestral geneh. consensussequence8. genes that arose by duplication within aspeciesi. gene family 9. genomic DNA sequences containing exonsj. paralogs 10. gene-poor region of the genomek. alternativeRNA splicing11. recently evolved from intergenic DNAsequencesl. protein domain 12. progressive…1. The simplest mobile elements in bacteria are called ___________________.A. insertion sequencesB. genesC. transposonsD. transposasesE. none of the above 2. ______________ worked in the area of chromosome biology using maize and suggested segments of the chromosome could "jump" to another location.A. Barbara HersheyB. Martha ChaseC. Barbara McClintockD. Rosalind FranklinE. None of the above 3. Transposition is a process in which a discrete DNA entity can move between DNA sites that lack homology using a self-encoded protein called a _______________.A. recombinaseB.kinaseC. transposaseD. mobilaseE. none of the above
- The technique of fluorescence in situ hybridization (FISH) is described. This is another method for examining sequence complexity within a genome. In this method, a DNA sequence, such as a particular gene sequence, can be detected within an intact chromosome by using a DNA probe that is complementary to the sequence.For example, let’s consider the β-globin gene, which isfound on human chromosome 11. A probe complementary to theβ-globin gene binds to that gene and shows up as a brightly colored spot on human chromosome 11. In this way, researchers can detectwhere the β-globin gene is located within a set of chromosomes. Becausethe β-globin gene is unique and because human cells are diploid(i.e., have two copies of each chromosome), a FISH experimentshows two bright spots per cell; the probe binds to each copy ofchromosome 11. What would you expect to see if you used thefollowing types of probes?A. A probe complementary to the Alu sequenceB. A probe complementary to a tandem array near…A researcher is interested in a gene found on human chromosome21. Describe the expected results of a FISH experiment using aprobe that is complementary to this gene. How many spots wouldyou see if the probe was used on a sample from an individual with46 chromosomes versus an individual with Down syndrome?1. What structures are these DNA strand likely to adopt in solution (assuming sufficient salt concentration to permit any hybridisation as appropriate)? Draw your answers depicting the hybridisation. a) GCC TTG AGC TTT TTT GCT CAA GGC (b) ATG ACT CTC GAG AGT CAT TTA TTA
- In the homologous recombination in bacteria, which of the following enzymes has a nuclease activity to resolve the Holliday junction? а. RuvA O b. RuvB С. RuvC O d. RecA2c) If the whole potoroo genome is 4.2 x 10' bp, and the highlyrepetitive DNA in the potoroo genome is composed entirely ofcopies of the sequence 5'AAGACT' and its complement, howmany copies of this sequence are present in the potoroogenome?3. After analyzing a DNA sequence for gene properties, the following sequences were reported at the positions provided at the table. Sequence Position (BP) TTGACA 18 TATAAT 42 AGGAGGT 75 ATG 86 UGA 187 TTTTTT 206 i. Identify what regions these positions represent. Provide justification for the identification. 2 ii. Draw an approximate diagram of the gene showing the regions. It is not necessary to draw it up to scale. 1 iii. What kind of organism does the Gene come from? Does the organism have a nucleus? Make an educated guess. 1 iv .Which of these positions would have been present if the organism was of the other type? Identify. 1