Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 10, Problem 13P
Summary Introduction
To analyze:
Considering the target sequence on a given fragment of DNA is
Introduction:
Molecular probe is a single – stranded
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
It is desired to isolate genomic DNA from liquid culture of S. cerevisiae yeast. A commercial kit will be used to isolate genomic DNA from this liquid culture. Answer the following questions to understand the strategy used by commercial kits for genomic DNA isolation.
a) List all the steps from cell pellet preparation to DNA elution.
b) With which feature can the membrane in the column that comes with the commercial kit bind DNA?
c) Which component in the kit would you use to recover the DNA from the membrane of the column to which the DNA was attached?
What would be a primer sequence synthesized from the following DNA sequence: 5'-ACGTG-3'?
When joining two or more DNA fragments, a researcher can adjust the sequence at the junction in a variety of subtle ways, as seen in the following exercises.(a) Draw the structure of each end of a linear DNA fragment produced by an EcoRI restriction digest (include those sequences remaining from the EcoRI recognition sequence).(b) Draw the structure resulting from the reaction of this end sequence with DNA polymerase I and the four deoxynucleoside triphosphates.(c) Draw the sequence produced at the junction that arises if two ends with the structure derived in (b) are ligated (d) Draw the structure produced if the structure derived in (a) is treated with a nuclease that degrades only single-stranded DNA.(e) Draw the sequence of the junction produced if an end with structure (b) is ligated to an end with structure (d).(f) Draw the structure of the end of a linear DNA fragment that was produced by a PvuII restriction digest (include those sequences remaining from the PvuII recognition…
Chapter 10 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Ch. 10 - Define the following terms as described in this...Ch. 10 - 2. Using sickle cell disease as an example,...Ch. 10 -
3. Compare and contrast the contributions of...Ch. 10 - Why do differences in protein electrophoretic...Ch. 10 - Prob. 5PCh. 10 - Prob. 6PCh. 10 - Prob. 7PCh. 10 - 8. Wildtype βglobin protein is composed of amino...Ch. 10 - Prob. 9PCh. 10 - Prob. 10P
Ch. 10 - 11. How is an autoradiograph produced from a...Ch. 10 - Prob. 12PCh. 10 - Prob. 13PCh. 10 - Prob. 14PCh. 10 - The family represented in the pedigree and...Ch. 10 - Suppose the mating couple (I-1 and I-2) shown in...Ch. 10 - What are restriction endonucleases, and why are...Ch. 10 - 18. Following restriction digestion, DNA fragments...Ch. 10 - 19. The doublestranded DNA sequence below is part...Ch. 10 - 20. Restriction enzymes recognize specific...Ch. 10 - Prob. 21PCh. 10 - Prob. 22PCh. 10 - Prob. 23PCh. 10 - Prob. 24PCh. 10 - 25. A second strain of dwarf plants has a...Ch. 10 - During gel electrophoresis of linear DNA...Ch. 10 - Prob. 27PCh. 10 - 28. In molecular biology, restriction...Ch. 10 - A complete plant gene containing four introns and...Ch. 10 - Prob. 30PCh. 10 - The map below illustrates three alleles in a...Ch. 10 - Prob. 32PCh. 10 - 33. Northern blot analysis is performed on mRNA...
Knowledge Booster
Similar questions
- Examine the structure of the pBR322 plasmid depicted below. Assume total size of the plasmid is 4,361 bp and the blue numbers indicate locations of restriction sites relative to the O point at the top of the plasmid. What size fragments would be generated by the following restriction digestion reactions? 1. Sall 2. Sal 1 + BamH1 3. Sal 1 + EcoR1 4. Sal I + BamH1 + EcoR1 PstI 3607 3000 4000 amp ori HindIII Edit View Insert Format Tools Table EcoRI EcoRV 4359 0 29 185 pBR322 4361 bp 2295 NdeI tet 2000 BamHI 375 651 SalI 1000 Type a short answer in the space provided below.arrow_forwardKornberg and his colleagues incubated soluble extracts of E. coli with a mixture of dATP, dTTP, dGTP, and dCTP, all labeled with 32P in the alpha-phosphate group. After a time, the incubation mixture was treated with trichloroacetic acid, which precipitates the DNA but not the nucleotide precursors. The precipitate was collected, and the extent of precursor incorporation into DNA was determined from the amount of radioactivity present in the precipitate. (a) If any one of the four nucleotide precursors were omitted from the incubation mixture, would radioactivity be found in the precipitate? Explain within 2 sentences. (2) (b) Would 32P be incorporated into the DNA if only dTTP were labeled? Explain within 2 sentences. (2) (c) Would radioactivity be found in the precipitate if 32P labeled the β or γ phosphate rather than the α phosphate of the deoxyribonucleotides? Explain within 2 sentences. (2)arrow_forwardwhat type of gel(in terms of material) can be more suitable for the electrophoresis of 500-1000bp DNA fragment and why?arrow_forward
- Consider the following plasmid (size 8000 bp), with restriction sites at the positions indicated: (see image) a) This plasmid is digested with the enzymes listed below. Indicate how many fragments will begenerated in each case, and give the sizes of the fragments.PstIXhoICombination of PstI + XhoI + EcoRI (triple digest) b) Draw the banding pattern you would expect to observe if each of these digestions is loaded into a separate well of an agarose gel, and the fragments separated by electrophoresis. In the first well you load a DNA marker (M) containing fragments with sizes of 1000 bp, 2000 bp, 4000 bp and 8000 bp. c) This gel is transferred to a membrane in a Southern blot experiment, and hybridised to a radioactively labelled 200 bp probe, which anneals to the plasmid DNA at the position indicated on the diagram above. Draw the autoradiographic profile you would expect to observe for the membrane.arrow_forwarda)Dr. Thisisaneasyexam decides to amplify a gene from a plasmid using PCR. She starts out with 6.6 x 10-14g of a 10 kb template in a 100 µl reaction. Assuming that the molecular weight of the average base pair is 660 Daltons calculate the number of molecules of the template. b)Given that the concentration of each primer (20 base pairs each) is 0.1µM in this same reaction volume (100 µl) calculate the number of molecules of the primer presentarrow_forwardThe chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?arrow_forward
- For human genomic DNA what is the expected fragment size for high molecular weight DNA extracts? What is an important component of gel electrophoresis which is omitted from this result, why would it be important to include ?arrow_forwardThe optimal design of primers is critical to the effective amplification of DNA sequences. i) Outline the criteria for optimal primer design. i) Illustrate forward and reverse primer sequences using an example of a hypothetical DNA fragment. Give a brief overview of an online primer design software program.arrow_forwardARE THEY TRUE OR FALSE? a) In a caesium chloride density gradient centrifugation method performed in the presence of ethidium bromide, supercoiled plasmid DNA binds more ethidium bromide than linear DNA. B)Tth DNA polymerase shows DNA-dependent DNA polymerase activity as well as RNA-dependent DNA polymerase activity. C)Magnesium ions stimulate polymerase activity. Therefore, it is better to use the highest concentration of magnesium in PCR amplification. D)When lambda bacteriophage infects E. coli cell lysis never occurs, and the infected bacterium can continue to grow and divide. E)The copy number refers to the number of molecules of an individual plasmid that are normally found in a single bacterial cell. F)RNase H selectively hydrolyzes phosphodiester bonds of RNA molecules in RNA:DNA duplexes.arrow_forward
- What volume of 4X loading buffer must be added to 21 micro L of DNA in a technique for DNA sample preparation for agarose gel electrophoresis to generate a 1X buffer solution?arrow_forwardYou are attempting to clone a 3 kb gene from the bacterial sp Microbacterium foliarum into the EcoRI site of the 6.0 kb plasmid shown. If you restrict the plasmid with EcoR1, how many bands will you obtain on agarose gel electrophoresis? Compare it with a plasmid in which no gene has been inserted. Draw a representative agarose gel showing the bands, and the direction of current flow as well point out the positive and negative electrodesarrow_forwardA) For this DNA fragment (from 5' to 3') "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary strand B) What are the products when the DNA with the above sequence is incubated with the restriction enzyme EcoRI C) What are the products when the DNA with the above sequence is incubated with the restriction enzyme Mspl D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key elements of the molecule including the bonds involvedarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education