Question asked to describe the molecular parameter that causes DNA fragments to have different electrophoretic mobility. Question asked to describe the parameter that causes different mobilities in mRNA. Question asked to describe the parameters that cause different mobilities in proteins. Introduction: Electrophoresis is an experimental approach for the separation of protein, DNA, and mRNA. The separation can be done on the basis of molecular weight, shape, and charge of protein DNA and mRNA under the electric field. Separation of proteins can be represented by the mathematical equation: μ e = q 6μηr Here, μ e = Mobility of sample in electrophoreses. q = Charge of sample. η = Given solution viscosity. r = Radius of sample. There are two different types of electrophoresis i.e. Polyacrylamide gel electrophoresis (PAGE) and sodium dodecyl sulfate (SDS). The moment of a molecule depends on the pore size of the gel.

Question

Want to see the full answer?

Answer 1

Question

Definition Definition Phase during which the number of bacteria cell deaths gradually equals the number of viable or actively dividing cells due to decreased reproduction rate. Microbes utilize all nutrients present in the growth medium to multiply during the growth of the bacterial population, which results in the deposition of waste matter, toxins, and inhibitory compounds in the media. This changes media conditions, such as temperature and pH, creating an unfavorable environment for bacterial growth. Here, the growth rate becomes stabilized.

Chapter 10, Problem 10P

Summary Introduction

To analyze:

Question asked to describe the molecular parameter that causes DNA fragments to have different electrophoretic mobility.

Question asked to describe the parameter that causes different mobilities in mRNA.

Question asked to describe the parameters that cause different mobilities in proteins.

Introduction:

Electrophoresis is an experimental approach for the separation of protein, DNA, and mRNA. The separation can be done on the basis of molecular weight, shape, and charge of protein DNA and mRNA under the electric field. Separation of proteins can be represented by the mathematical equation:

μe = q6μηr

Here,

μe = Mobility of sample in electrophoreses.

q = Charge of sample.

η = Given solution viscosity.

r = Radius of sample.

There are two different types of electrophoresis i.e. Polyacrylamide gel electrophoresis (PAGE) and sodium dodecyl sulfate (SDS). The moment of a molecule depends on the pore size of the gel.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

As you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________

What is an Okazaki fragment, and how are they later “glued” together? What are the types and major functions for each type of RNA? Define transcription and translation. Which process occurs first to make protein from DNA? In what direction does a polymerase move when synthesizing a strand of mRNA? What mRNA sequence is synthesized from a section of DNA that is 3’-TTGACCT-5’?

If the following nucleotide sequence, CTC/TGT/AAG/ACC/TTT experienced a mutation resulting in the deletion of the second cytosine in the first DNA triplet so the sequence is now CT_/TGT/AAG/ACC/TTT, what would be the amino acid sequence created from this mutated DNA strand? Table of mRNA codons UUA, UUG = leucine AGG, AGA = arginine %3D CAU, CAC = histidine GUU, GÜC, GUA = valine GAA. GAG=glutamic acid GCU, GUA, GUG = alanine GAU, GAC = asparagine GGU, GGC, GGA = glycine UCA, UCU =serine CGU, CGC, CGA = arginine

Answer 2

Question

Definition Definition Phase during which the number of bacteria cell deaths gradually equals the number of viable or actively dividing cells due to decreased reproduction rate. Microbes utilize all nutrients present in the growth medium to multiply during the growth of the bacterial population, which results in the deposition of waste matter, toxins, and inhibitory compounds in the media. This changes media conditions, such as temperature and pH, creating an unfavorable environment for bacterial growth. Here, the growth rate becomes stabilized.

Chapter 10, Problem 10P

Summary Introduction

To analyze:

Question asked to describe the molecular parameter that causes DNA fragments to have different electrophoretic mobility.

Question asked to describe the parameter that causes different mobilities in mRNA.

Question asked to describe the parameters that cause different mobilities in proteins.

Introduction:

Electrophoresis is an experimental approach for the separation of protein, DNA, and mRNA. The separation can be done on the basis of molecular weight, shape, and charge of protein DNA and mRNA under the electric field. Separation of proteins can be represented by the mathematical equation:

μe = q6μηr

Here,

μe = Mobility of sample in electrophoreses.

q = Charge of sample.

η = Given solution viscosity.

r = Radius of sample.

There are two different types of electrophoresis i.e. Polyacrylamide gel electrophoresis (PAGE) and sodium dodecyl sulfate (SDS). The moment of a molecule depends on the pore size of the gel.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Definition Definition Phase during which the number of bacteria cell deaths gradually equals the number of viable or actively dividing cells due to decreased reproduction rate. Microbes utilize all nutrients present in the growth medium to multiply during the growth of the bacterial population, which results in the deposition of waste matter, toxins, and inhibitory compounds in the media. This changes media conditions, such as temperature and pH, creating an unfavorable environment for bacterial growth. Here, the growth rate becomes stabilized.

Chapter 10, Problem 10P

Summary Introduction

To analyze:

Question asked to describe the molecular parameter that causes DNA fragments to have different electrophoretic mobility.

Question asked to describe the parameter that causes different mobilities in mRNA.

Question asked to describe the parameters that cause different mobilities in proteins.

Introduction:

Electrophoresis is an experimental approach for the separation of protein, DNA, and mRNA. The separation can be done on the basis of molecular weight, shape, and charge of protein DNA and mRNA under the electric field. Separation of proteins can be represented by the mathematical equation:

μe = q6μηr

Here,

μe = Mobility of sample in electrophoreses.

q = Charge of sample.

η = Given solution viscosity.

r = Radius of sample.

There are two different types of electrophoresis i.e. Polyacrylamide gel electrophoresis (PAGE) and sodium dodecyl sulfate (SDS). The moment of a molecule depends on the pore size of the gel.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Definition Definition Phase during which the number of bacteria cell deaths gradually equals the number of viable or actively dividing cells due to decreased reproduction rate. Microbes utilize all nutrients present in the growth medium to multiply during the growth of the bacterial population, which results in the deposition of waste matter, toxins, and inhibitory compounds in the media. This changes media conditions, such as temperature and pH, creating an unfavorable environment for bacterial growth. Here, the growth rate becomes stabilized.

Chapter 10, Problem 10P

Summary Introduction