Concept explainers
A complete plant gene containing four introns and five exons is carried on a
Want to see the full answer?
Check out a sample textbook solutionChapter 10 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Additional Science Textbook Solutions
SEELEY'S ANATOMY+PHYSIOLOGY
Human Physiology
Microbiology Fundamentals: A Clinical Approach - Standalone book
LooseLeaf for Integrated Principles of Zoology
Essentials of Human Anatomy & Physiology (11th Edition)
- Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases will the pre mRNA transcript be? Explain briefly. What is the maximum number of amino acids that could make up the protein product from the final mRNA? Explain briefly.arrow_forwardImagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow Fluorescent Protein (YFP). To generate the YFP, you know the pre-MRNA looks as follows: Unspliced YFP premature mRNA Сap 5' UTR Exon 1 Intron Exon 2 Intron Exon 3 3' UTR Poly-A tail If Exon 2 is also required for mRNA stability, what can be predicted from the possible spliced alternative isoforms formed? One of the isoforms will not have a poly-A tail O The alternative splicing of YFP pre-MRNA prevents 5'-capping The MRNA isoform without Exon 2 will be degraded faster than the other isoform Exon 2 will be added to isoform B later to correct the mistake in splicing The protein translated from one of the mRNA isoforms will possess an additional functional domainarrow_forwardThe DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ Draw boxes around any structures or bases that were added to the RNA during processing.arrow_forward
- The DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ How many amino acids are in the peptide encoded by the gene? _____________arrow_forward1. You are investigating a protein that has the amino acid sequence N ... Ala – Thr - Asn – Trp – Lys - Arg - Gly – Phe – Thr ... C within its primary structure. You found that several of the mutations affecting this protein produced shortened protein molecules that terminated within this region. In one of the mutants, the Asn became the terminal (last) amino acid. (a) What DNA single-base changes(s) would cause the protein to terminate at the Asn residue? (b) What other potential sites do you see in the DNA sequence encoding this protein where mutation of a single base pair would cause premature termination of translation? >arrow_forwardThe DNA sequence of a short gene from a sea slug, and the mature RNA synthesized from this gene, are shown below. DNA sequence: 5’ - AGCATCTCATGTGCGAGTCCTGACGCTGACTAGC – 3’ 3’ - TCGTAGAGTACACGCTCAGGACTGCGACTGATCG – 5’ mature mRNA: 5’ – cap-AUCUCAUGUGCGAACGCUGACUAGAAAAAAAAAA- 3’ In the DNA sequence, draw boxes around two exons in the gene. The splicing machinery does NOT pay attention to codons. The splicing of this DNA demonstrates that. How?arrow_forward
- The primary RNA transcript of the chicken ovalbumin gene is 7700 nucleotides long, but the mature mRNA that is translated on the ribosome is 1872 nucleotides long. This size difference occurs primarily as a result of: capping cleavage of polycistronic mRNA removal of poly A tails reverse transcription splicingarrow_forwardThe following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. Draw or write-out a) the sequence of the primary transcript and b) the mature mRNA resulting from this stretch of DNA.arrow_forwardFor a specific type of mutation at a given location in a particular gene, identify whether it will affect the size of the mRNA, the protein, or both. How would the mutant appear on a gel in comparison to the originalarrow_forward
- NASA has identified a new microbe present on Mars and requests that you determine the genetic code of this organism. To accomplish this goal, you isolate an extract from this microbe that contains all the components necessary for protein synthesis except mRNA. Synthetic mRNAs are added to this extract and the resulting polypeptides are analyzed: Synthetic mRNA Resulting Polypeptides AAAAAAAAAAAAAAAA Lysine-Lysine-Lysine etc. CACACACACACACACA Threonine-Histidine-Threonine-Histidine etc. AACAACAACAACAACA Threonine-Threonine-Threonine etc. Glutamine-Glutamine-Glutamine etc. Asparagine-Asparagine-Asparagine etc. From these data, what specifics can you conclude about the microbe’s genetic code? What is the sequence of the anticodon loop of a tRNA carrying a threonine? If you found that this microbe contained 61 different tRNAs, what could you speculate about the fidelity of translation in this organism?arrow_forwardc) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…arrow_forwardThe sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide highlighted by the arrow. If the upper strand shown is the template strand, write the sequence you expect for the mRNA transcribed from this gene. Please write 5' to 3'. 5'-[x]-3' 5'-TACGTGACGGTAATACTAGC-3' 3'-ATGCACTGCCATTATGATCG-5'arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning