Genetics: From Genes to Genomes, 5th edition
5th Edition
ISBN: 9780073525310
Author: Leland H. Hartwell, Michael L. Goldberg, Janice A. Fischer, Leroy Hood, Charles F. Aquadro
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 23P
The following is a sequence of the leader region of the his operon mRNA in Salmonella typhimurium. What bases in this sequence could cause a ribosome to pause when histidine is limiting (that is, when there is very little of it) in the medium?
5′AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCA UCCUGACUAGUCUUUCAGGC3′
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A number of mutations affect the expression of the lac operon in E. coli. The
genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene
with normal function and "-" indicates a loss-of-function allele.) Please predict which
of the following strains would have the highest beta-galactosidase enzyme activity,
when grown in the lactose medium.
O CAP+ r* p* o* z
O CAP* I P* o* z*
O CAP* r* P O* z*
O CAP I P* O z*
The lac operon has 4 genes, I, Z, Y and A. For each scenario, tell me the result of the mutation, what would happen if this mutant was in the presence of lactose and why.
A) Lac I is mutated/not functional -
B) Lac Y is mutated/not functional -
A number of mutations affect the expression of the lac operon in E. coli. The
genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene
with normal function and "-" indicates a loss-of-function allele.) Please predict which
of the following strains would have the lowest beta-galactosidase enzyme activity,
when grown in the lactose medium.
Orpt o* z* r*
Orpt ot z* Y
OrptoztY
Orrotzr
OrPotz*Y
Chapter 15 Solutions
Genetics: From Genes to Genomes, 5th edition
Ch. 15 - For each of the terms in the left column, choose...Ch. 15 - The following statement occurs early in this...Ch. 15 - One of the main lessons of this chapter is that...Ch. 15 - All mutations that abolish function of the Rho...Ch. 15 - The promoter of an operon is the site to which RNA...Ch. 15 - You are studying an operon containing three genes...Ch. 15 - Prob. 7PCh. 15 - You have isolated two different mutants reg1 and...Ch. 15 - Bacteriophage , after infecting a cell, can...Ch. 15 - Mutants were isolated in which the constitutive...
Ch. 15 - For each of the E. coli strains containing the lac...Ch. 15 - For each of the growth conditions listed, what...Ch. 15 - For each of the following mutant E. coli strains,...Ch. 15 - Maltose utilization in E. coli requires the...Ch. 15 - Seven E. coli mutants were isolated. The activity...Ch. 15 - Prob. 16PCh. 15 - Six strains of E.coli mutants 16 that had one of...Ch. 15 - a. The original constitutive operator mutations in...Ch. 15 - Prob. 19PCh. 15 - Figure 15.16 on p. 525 shows that in the lac...Ch. 15 - Why is the trp attenuation mechanism unique to...Ch. 15 - a. How many ribosomes are required at a minimum...Ch. 15 - The following is a sequence of the leader region...Ch. 15 - For each of the E. coli strains that follow,...Ch. 15 - One mechanism by which antisense RNAs act as...Ch. 15 - For each element in the list that follows,...Ch. 15 - Great variation exists in the mechanisms by which...Ch. 15 - Many genes whose expression is turned on by DNA...Ch. 15 - Prob. 29PCh. 15 - The E.coli MalT protein is a positive regulator of...Ch. 15 - Prob. 31PCh. 15 - To find genes that are turned on or off in...Ch. 15 - Prob. 33PCh. 15 - Prob. 34PCh. 15 - Prob. 35PCh. 15 - The researchers who investigated bioluminescence...Ch. 15 - Prob. 37PCh. 15 - Quorum sensing controls the expression of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Figure 5 shows the lac operon structure in Escherichia coli. a) Name structures P, Q and R. b) Name substance S. c) What is the enzyme encoded by gene I. Give its function. d) What will happen if substance S is absent in the medium?arrow_forwardWhich of the following lac operon genotypes would allow for functional versions of all the structural enzymes of the lac operon to be expressed constitutively even in the absence of lactose? Group of answer choices I+ O+ Z+ Y+ A+ I- O+ Z- Y- A- I+ OC Z+ Y+ A+ IS O+ Z+ Y+ A+ I+ O+ Z- Y+ A+arrow_forwardUse the blanks on the left hand side to put the following statements in order (use numbers or letters to designate the order). All of the statements refer to the diauxic (sequential) growth of a bacterium on the carbon substrates glucose and lactose (see textbook Fig 4.11 on diauxic growth). Remember, the lac operon contains the genes necessary for the lactose catabolism. The glucose substrate is completely consumed, at which time the repressor protein on the lac operon unbinds from the DNA molecule. The lactose substrate is catabolized by the active B-galactosidase enzyme. Glucose, as the preferred carbon substrate, is first consumed by catabolic enzymes that are constitutive (always present). After completion of translation, the B-galactosidase enzyme undergoes folding to form into an active enzyme that can breakdown lactose into its constituent monosaccharides. The messenger RNA code from the lac operon is translated by ribosomal RNAS to form lac-related enzymes, such as…arrow_forward
- The lac operon consists of three structural genes, lacZ, lacY and lacA that are transcribed as a single polycistronic mRNA. You are given a new strain of Escherichia coli with the following lac operon genotype: p+0°Z•Y*A +// P*O*Z*Y+ A- (i) Explain how the lac I ³ gene affects gene expression.arrow_forwardA number of mutations affect the expression of the lac operon in E. coli. The genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene with normal function and "-" indicates a loss-of-function allele.) Please predict which of the following strains would have the highest beta-galactosidase enzyme activity, when grown in the lactose medium. CAP It P+ O`Z+ CAP+ I P+ O+ Zt CAP+ It P- O+ Z+ CAP+ It P+ 0+ Zarrow_forwardWhat would happen if the operator sequence of the trp operon contained a mutation that prevented the repressor protein from binding to the operator? (Explain what would happen in both the presence and absence of tryptophan)arrow_forward
- The streptolysin S toxin made by S. pyogenes is encoded by a 9-gene operon, sagABCDEFGHI. Thinking about what a 3-line diagram would look like for this operon, answer the following questions. Write numeric answers only. For example, if your answer is 6 promoters, write only 6. 1) How many promoters control the expression of these genes? 2) How many locations does RNA Polymerase bind to get full expression of these genes? 3) How many ribosome binding sites are needed for full protein expression? 4) How many start codons will be needed for full protein expression? 5) How many mRNA strands will be produced with full operon expression? 6) How many proteins will be produced with full protein expression? 1arrow_forwardThe lac operon consists of three structural genes, lacZ, lacY and lacA that are transcribed as a single polycistronic mRNA. You are given a new strain of Escherichia coli with the following lac operon genotype: p+0°Z•Y*A +// P*O*Z*Y+ A- (i) Explain how the lac I gene affects gene expression. (ii) Explain the function of the lacP in the bacterial operon. (iii) Which part of the lac operon is cis-dominant? Explain.arrow_forwardA number of mutations affect the expression of the lac operon in E. coli. Consider each genotype below and complete the table using “+” to indicate that the gene is expressed, and “−” to indicate that gene is not expressed.arrow_forward
- For the following E.coli genotype trpR- trpP+ trpO+ trpE- / trpR- trpP+ trpO+ trpE+ the production of the first enzyme (trpE) in the tryptophan operon is zero repressible constitutive induciblearrow_forwardPlease complete the table representing the regulation of the lactose operon. Please highlight any data that provides evidence of trans regulation.arrow_forwardThe following sequence is from a region of the M13 bacteriophage genome. Identify and label the promoter elements that would be recognized by the bacterial RNA polymerase. Where would transcription begin? CAGGCGATGATCAAATCTCCGTTGTACTTTGTTTCGCGCGTTGGTATAATCGCTGGGGTCAAGATGAGTarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license