![Genetics: From Genes to Genomes, 5th edition](https://www.bartleby.com/isbn_cover_images/9780073525310/9780073525310_largeCoverImage.gif)
Concept explainers
a.
To determine:
The reason behind the appearance of white color of luxR/lacZ colonies in the absence of autoinducer.
Introduction:
In an experiment to understand the molecular mechanism of quorum sensing, the use of two transcriptional fusion reporter genes was involved each having the 9 kb fragment of Vibrio fischeri DNA.
b.
To determine:
The reason behind the appearance of white color of luxICDABE/lacZ colonies in the absence of autoinducer.
Introduction:
In a reporter known as luxICDABE/lacZ, the luxICDABE operon regulatory sequences drive lacZ expression. It means that the structural genes of the operon are replaced by the lacZ coding sequences.
c.
To determine:
The reason behind the appearance of white color of luxR/lacZ colonies in the presence of autoinducer.
Introduction:
In the reporter known as luxR/lacZ, the luxR regulatory region drives the transcription of lacZ. It means that the luxR coding sequences are replaced by the lacZ.
d.
To determine:
The reason behind the appearance of blue colored luxICDABE/lacZ colonies in the presence of autoinducer and the time-dependency of the reaction.
Introduction:
The E.coli that contains either of the reporter (luxR/lacZ or luxICDABE/lacZ) has white colonies. When the purified autoinducer is added to the media, the luxR/lacZ colonies remain white but the luxICDABE/lacZ colonies turn blue over time.
e.
To determine:
The inference that can be made out about the transcription of the luxR gene from the given results.
Introduction:
The regulatory region of luxR drives the transcription of the lacZ gene. It indicates that the coding sequence of luxR is replaced by the coding sequence of lacZ.
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 15 Solutions
Genetics: From Genes to Genomes, 5th edition
- The locations of the TATA box in two species of yeast, Saccharomyces pombe and Saccharomyces cerevisiae, differ dramatically. The TATA box of S. pombe is about 30 nucleotides upstream of the transcription start site, similar to the location in most other eukaryotic cells. However, the TATA box of S. cerevisiae is 40 to 120 nucleotides upstream of the start site. To better understand what sets the start site in these organisms, researchers at Stanford University conducted a series of experiments to determine which components of the transcription apparatus of these two species could be interchanged (Y. Li et al. 1994. Science 263:805–807). In these experiments, different general transcription factors and RNA polymerases were switched in S. pombe and S. cerevisiae, and the effects of each switch on the level of RNA synthesis and on the starting point of transcription were observed. The results from one set of experiments are shown in the table below. Components cTFIIB, cTFIIE, cTFIIF,…arrow_forwardThe locations of the TATA box in two species of yeast, Saccharomyces pombe and Saccharomyces cerevisiae, differ dramatically. The TATA box of S. pombe is about 30 nucleotides upstream of the transcription start site, similar to the location in most other eukaryotic cells. However, the TATA box of S. cerevisiae is 40 to 120 nucleotides upstream of the start site. To better understand what sets the start site in these organisms, researchers at Stanford University conducted a series of experiments to determine which components of the transcription apparatus of these two species could be interchanged (Y. Li et al. 1994. Science 263:805–807). In these experiments, different general transcription factors and RNA polymerases were switched in S. pombe and S. cerevisiae, and the effects of each switch on the level of RNA synthesis and on the starting point of transcription were observed. The results from one set of experiments are shown in the table below. Components cTFIIB, cTFIIE, cTFIIF,…arrow_forwardThe genes that encode the enzymes for arginine biosynthesis are located at several positions around the genome of E. coli, and they are regulated coordinately by a transcription regulator encoded by the ArgR gene. The activity of the Argr protein is modulated by arginine. upon binding arginine, Argr alters its conformation, dramatically changing its affinity for the DNA sequences in the promoters of the genes for the arginine biosynthetic enzymes. given that ArgR is a repressor protein, would you expect that ArgR would bind more tightly or less tightly to the DNA sequences when arginine is abundant? if ArgR functioned instead as an activator protein, would you expect the binding of arginine to increase or to decrease its affinity for its regulatory DNA sequences? explain your answers.arrow_forward
- An electrophoretic mobility shift assay can be used to study the binding of proteins to a segment of DNA. In the results shown here, an EMSA was used to examine the requirements for the binding of RNA polymerase |l (from eukaryotic cells) to the promoter of a protein-encoding gene. The assembly of general transcription factors and RNA polymerase Il at the core promoter is described in Week 4. In this experiment, the segment of DNA containing a promoter sequence was 1100 bp in length. The fragment was mixed with various combinations of proteins and then subjected to an EMSA. Lane 1: No proteins added Lane 2: TFIID Lane 3: TFIIB Lane 4: RNA polymerase IIl Lane 5: TFIID + TFIIB Lane 6: TFIID + RNA 1 2 3 4 5 6. 7 polymerase II Lane 7: TFIID + TFIIB + RNA polymerase Il 1100 bp Explain the results.arrow_forwardTermicin is a small antifungal protein in termites that is produced by cells and secreted into termite saliva in response to a pathogen. In vitro translation of the termicin-encoding gene is performed, and the effects of that product are compared to those of termicin extracted from a termite. You see that extracted termicin exhibits more antifungal behavior than in vitro translated termicin. After further analysis, you see that extracted termicin contains 3 disulfide bonds, while in vitro translated termicin contains zero. The addition of microsomes to the in vitro translation reaction results in termicin with all 3 disulfide bonds. What experimental condition is most likely responsible for this difference? A. in vitro translation was not performed at the correct temperature affecting protein folding B. a mutation occurred during in vitro translation, leading to differences in disulfide bond formation O C. the UPR can not be activated in vitro, therefore, this protein can only be…arrow_forwardGal4 is a transcription factor that activates transcription of galactose metabolism genes in yeast. These genes are ‘turned on’ when yeast cells need to metabolize galactose. To identify promoter sequences necessary for regulation of transcription of GAL1, reporter gene fusions were made and introduced into yeast cells. Deletions of GAL1 promoter were cloned upstream of LacZ gene. β-Galactosidase activity was measured in presence of galactose. Shown below is a representation of the results obtained. In the diagrams below (not to scale!): • Construct 1 contains ~ 130bp of the promoter, which is predicted to have all the predicted/putative proximal promoter elements (indicated by the solid boxes) needed to regulate transcription of GAL1.• The stippled box is the core promoter.• The arrow represents the transcriptional start site for the reporter gene Lac Z• Number of + signs represents level of transcription• Star represents a mutation in DNA sequence at that location (few nucleotides…arrow_forward
- GR and PPAR are transcription factors that bind to GRE and PPARE sequences respectively and activate transcription of genes. A reporter cell line is created in which the the green fluoresecent protein (GFP) is controlled by a GRE sequence and the pink fluorescent protein mCherry is under control of a PPARE sequence. If the gene for GR is introduced into the reporter cell line, the cells produce a green color. Chimeric proteins are created in which the DNA Binding Domains (DBD) and Activation Domains (AD) of the transcription factors are introduced into various cell lines. Match the following cell-types with the fluorescent color(s) you would expect the cells to produce.arrow_forwardThe following logo plot represents the preferred cis-regulatory sequences (i.e. transcription factor binding site) of bHLH transcription factor FOSL1. C 1 2 3 4 5 6 7 8 9 10 11 position Would you expect this sequence to be recognized by a monomer, a homodimer, or a heterodimer of the protein? Explain your answer. (short phrases are sufficient; please write your answer into the template below) A- В I A -l expect FOSL1 to bind as a: (monomer, homodimer, heterodimer; please choose) B - short explanation: information content (bit) !!arrow_forwardThe yeast gene SER3, whose product has a role in serine biosynthesis, is repressed during growth in nutrient-rich medium, so little transcription takes place, and little SER3 enzyme is produced, under these conditions. In an investigation of the repression of the SER3 gene, a region of DNA upstream of SER3 was found to be heavily transcribed when SER3 is repressed (J. A. Martens, L. Laprade, and F. Winston. 2004. Nature 429:571–574). Within this upstream region is a promoter that stimulates the transcription of an RNA molecule called SRG1 RNA (for SER3 regulatory gene 1). This RNA molecule has none of the sequences necessary for translation. Mutations in the promoter for SRG1 result in the disappearance of SRG1 RNA, and these mutations remove the repression of SER3. When RNA polymerase binds to the SRG1 promoter, the polymerase travels downstream, transcribing the SGR1 RNA, and passes through and transcribes the promoter for SER3. This activity leads to the repression of SER3. Propose…arrow_forward
- Shown below is a schematic diagram illustrating a very short gene with 5000 bp region of an unknown Schizosaccharomyces pombe genome. (Note: Transcription starts at Transcription Start Site (TSS).) TSS 5. 3' 3 +1 (i) Name the specific regions that can be recognized by Transcription Factor IID (TF ID) and indicate the locations in the diagram above. (ii) List the mechanistic steps that can trigger the initiation of transcription by Transcription Factor IIH (TF IIH).arrow_forwardYou made four mutants for a promoter sequence in DNA and studied them for transcription. The results of the amount of gene expression or transcription (based on beta-Gal activity shown on Y-axis) for these DNAs (X-axis) are shown. The sequence of the wild-type and mutant DNAs, and consensus sequence from many promoters are shown here for your convenience. From this experiment you can conclude that: Nucleotide substitution can identify important bases of the binding sites or promoter in DNA (e.g., -10 and -35 promoter sequences of lac operon). True or false: Spacer (a) -10 region -35 region TTGACA Consensus sequence TATAAT Wild-type Lac promoter GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATT Mutant 1 GGCTTTACACTTTATG-TTCCGGCTCGTATGTTGTGTGGAATT Mutant 2 GGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATT Mutant 3 GGCTTTACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT Mutant 4 GGCTTGACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT (b) 700 600- 500- 400- 300- 200- 100. 0 ● True O False B-Galactosidase activity Wild-type…arrow_forwardNegative supercoiling of DNA favors the transcription of genes because it facilitates unwinding. However, not all promoter sites are stimulated by negative supercoiling. The promoter site for topoisomerase II itself is a noteworthy exception. Negative supercoiling decreases the rate of transcription of this gene. Propose a possible mechanism for this effect and suggest a reason why it may occur.arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)