Genetics: From Genes to Genomes, 5th edition
5th Edition
ISBN: 9780073525310
Author: Leland H. Hartwell, Michael L. Goldberg, Janice A. Fischer, Leroy Hood, Charles F. Aquadro
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 15P
Seven E. coli mutants were isolated. The activity of the enzyme β-galactosidase produced by cells containing each mutation alone or in combination with other mutations was measured when the cells were grown in medium with different carbon sources.
Assume that each of the seven mutations is one and only one of the genetic lesions in the following list. Identify the type of alteration each mutation represents.
| a. superrepressor |
| b. operator deletion |
| c. nonsense (amber) suppressor tRNA gene (assume that the suppressor tRNA is 100% efficient in suppressing amber mutations) |
| d. defective CRP–cAMP binding site |
| e. nonsense (amber) mutation in the β-galactosidase gene |
| f. nonsense (amber) mutation in the repressor geneg. defective crp gene (encoding the CRP protein) |
| g. defective crp gene (encoding the CRP protein) |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Another class of suppressor mutations, not describedin the chapter, are mutations that suppress missensemutations.a. Why would bacterial strains carrying such missense suppressor mutations generally grow moreslowly than strains carrying nonsense suppressormutations?
CTP synthetase catalyzes the glutamine-dependent conversion of UTP to
CTP. The enzyme is allosterically inhibited by the product, CTP. Mamma-
lian cells defective in this allosteric inhibition are found to have a complex
phenotype: They require thymidine in the growth medium, they have unbal-
anced nucleotide pools, and they have an elevated spontaneous mutation
rate. Explain the likely basis for these observations.
A number of mutations affect the expression of the lac operon in E. coli. The
genotypes of several E. coli strains are shown below. ("+" indicates a wild-type gene
with normal function and "-" indicates a loss-of-function allele.) Please predict which
of the following strains would have the lowest beta-galactosidase enzyme activity,
when grown in the lactose medium.
Orpt o* z* r*
Orpt ot z* Y
OrptoztY
Orrotzr
OrPotz*Y
Chapter 15 Solutions
Genetics: From Genes to Genomes, 5th edition
Ch. 15 - For each of the terms in the left column, choose...Ch. 15 - The following statement occurs early in this...Ch. 15 - One of the main lessons of this chapter is that...Ch. 15 - All mutations that abolish function of the Rho...Ch. 15 - The promoter of an operon is the site to which RNA...Ch. 15 - You are studying an operon containing three genes...Ch. 15 - Prob. 7PCh. 15 - You have isolated two different mutants reg1 and...Ch. 15 - Bacteriophage , after infecting a cell, can...Ch. 15 - Mutants were isolated in which the constitutive...
Ch. 15 - For each of the E. coli strains containing the lac...Ch. 15 - For each of the growth conditions listed, what...Ch. 15 - For each of the following mutant E. coli strains,...Ch. 15 - Maltose utilization in E. coli requires the...Ch. 15 - Seven E. coli mutants were isolated. The activity...Ch. 15 - Prob. 16PCh. 15 - Six strains of E.coli mutants 16 that had one of...Ch. 15 - a. The original constitutive operator mutations in...Ch. 15 - Prob. 19PCh. 15 - Figure 15.16 on p. 525 shows that in the lac...Ch. 15 - Why is the trp attenuation mechanism unique to...Ch. 15 - a. How many ribosomes are required at a minimum...Ch. 15 - The following is a sequence of the leader region...Ch. 15 - For each of the E. coli strains that follow,...Ch. 15 - One mechanism by which antisense RNAs act as...Ch. 15 - For each element in the list that follows,...Ch. 15 - Great variation exists in the mechanisms by which...Ch. 15 - Many genes whose expression is turned on by DNA...Ch. 15 - Prob. 29PCh. 15 - The E.coli MalT protein is a positive regulator of...Ch. 15 - Prob. 31PCh. 15 - To find genes that are turned on or off in...Ch. 15 - Prob. 33PCh. 15 - Prob. 34PCh. 15 - Prob. 35PCh. 15 - The researchers who investigated bioluminescence...Ch. 15 - Prob. 37PCh. 15 - Quorum sensing controls the expression of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- a. Some antibiotics, such as rifampin, interfere with the function of RNA polymerase. What biological process is rifampin disrupting? b. Some antibiotic-resistant M. tuberculosis bacteria have a single point mutation (CàT) in the rpoB gene that causes an amino acid change from serine (a polar amino acid) to leucine (a non-polar amino acid). What type of mutation is this? Do you expect this to have no effect, a small effect, or a large effect on the polypeptide produced? Explain your reasoning. c. The rpoB gene encodes a subunit of the bacterial RNA polymerase protein. The point mutation described in Question 2 causes a change in protein folding, which leads to the inability of the rifampin antibiotic to bind to the RNA polymerase. Which level(s) of protein structure is/are affected by this change?arrow_forwardAssume that there is a double stranded break on DNA double helix of an eukaryotic cell due to X-ray radiation and it is not repaired. In addition, the cell’s Apaf-1 protein is not expressed due to a null mutation in the Apaf-1 gene. Please discuss the effect of not having Apaf-1 expression in the cell with non-repaired double stranded break.arrow_forwardConsider the following simple regulatory pathways. Assume the full pathway is shown. A- E- B- F- C- G- D- 1 H- A You identify several null mutations (a complete deletion of the gene). For each mutant (ind with a - sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. 2 B 3 C 4 D inducible inducible constitutive uninducible constitutive inducible inducible E uninducible F G H > > >arrow_forward
- An individual carries a somatic mutation that changes a lysinecodon into a glutamic acid codon. Prior to acquiring this mutation,the individual had been exposed to UV light, proflavin, and5-bromouracil. Which of these three agents would be the mostlikely to have caused this somatic mutation? Explain your answer.arrow_forwardConsider the following simple regulatory pathways. Assume the full pathway is shown. A- E- B- F- C- G- D- 1 A H- 2 B || L You identify several null mutations (a complete deletion of the gene). For each mutant (indicated with a - sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. 3 C 4 D- [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] [Choose ] E [Choose ] F G I H || J Karrow_forwardDescribe how transcription would be affected in the Galactose metabolizing pathway in Yeast in the presence of the following mutations. 1. A mutation that resulted in an inability of Gal80 to enter the nucleus. 2. A mutation that resulted in a lack of ability of Gal3 to bind galactose.arrow_forward
- The lac genotypes are as shown below: P+OcZ-Y+A+// P¯O+Z+Y+A+ (i) The lac operon consists of three structural genes, lacZ, lacY and lacA. Which structural genes are involved in lactose metabolism? Explain. (ii) Draw and explain how lactose repress the gene expression in lac IS/I- heterozygote. (iii) What is the function of the promoter in the bacterial operon?arrow_forwardWassif et al. created a mouse knockout of DHCR7 (7-dehydrocholesterol reductase) gene. A.) Which disease or medical problem did Wassif et al. want to tackle with this mouse knockout? (If you cannot remember you may describe it.) B.) How did the phenotype of their mouse model differ from those of patients who had mutations in DHCR7 gene? And how was it similar? C.) What is one reason to explain the differences between the DHCR7 mouse knockout model and human patients with the mutations in the DHCR7 gene OTHER THAN the fact that they are two different organisms with differences in their biology? D.) With your BIOL2299 expertise, assume you generate a mouse knockout model of a human disease. Imagine one real world outcome from your study which can be applied in a clinical setting to help patients with that disease. Answer in one or two sentences.arrow_forwardThe following is a list of mutational changes. For each of the specific mutations described, indicate which of the following terms could apply, either as a description of the mutation or as a possible cause. More than one term from the right column can apply to each statement in the left column. 1. an A-T base pair in the wild-type gene is changed to a G-C pair 2. an A-T base pair is changed to a T-A pair a. transition b. base substitution c. transversion 3. the sequence AAGCTTATCG is changed to d. inversion AAGCTATCG c. translocation f. deletion 4. the sequence AAGCTTATCG is changed to AAGCTTTATCG g. insertion 5. the sequence AACGTTATCG is changed to AATGTTATCG h. decamination 6. the sequence AACGTCACACACACATCG is i. X-ray irradiation changed to AACGTCACATCG j. intercalator 7. the gene map in a given chromosome arm is changed from bog-rad-fox1-fox2-try-duf (where foxl and fox2 are highly homologous, recently diverged genes) to bog-rad-fox1-fox3- fox2-try-duf (where fox3 is a new gene…arrow_forward
- Cx is a member of the family of connexin genes that encode the proteins of gap junction intercellular channels. Cx proteins in one cell form hemi-channels in the plasma membrane. Hemi-channels in adjacent cells dock to form complete intercellular channels through which ions and small molecules diffuse from cell to cell. Distinct Cx mutations were identified in three different families, F1, F2 and F3, affected by the same disease. To study their functional properties, normal (wild type, wt) and mutant (m) Cx proteins were expressed in cultured cells. Translation of the proteins was checked (Fig. 3). A extracellular EC 1 SM TM 1 membrane 2 3 4 F10 intracellular N F2 EC 2 F3 oricand c B 42 kDa C 42 kDa 35 kDa Control wt m-F1 m-F2 PM C PM C PM C PM C Western blot anti-Cx Control wt PM C m-F1 PM C PM C = Metabolically labelled m-F2 PM C m-F3 PM C m-F3 PM C WSEY Fig. 3 mont (A). Membrane topology of Cx protein indicating positions of mutations. Cx is an integral membrane protein with 4…arrow_forwardThe following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairingarrow_forwardA mutant has no activity for the enzyme isocitrate lyase.Does this result prove that the mutation is in the geneencoding isocitrate lyase?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY