a.
To determine:
The genotype of the parental type sperm John could produce in the given cross.
Introduction:
The set of genes in our DNA that is responsible for a certain trait is termed as the genotype. If the two organisms have even the slightest difference, their gene will have different genotypes.
b.
To determine:
The genotype of the recombinant type sperm produced by John.
Introduction:
The genetic makeup of an organism is termed as the genotype. It describes a complete set of genes of an organism.
c.
To determine:
Whether the B and D loci are linked or assort independently.
Introduction:
According to Gregor Mendel’s law of independent assortment, when two or more traits are inherited, the alleles for separate traits are transmitted to the next generation independent of each other. The assortment of one allele does not affect the selection of the other trait. When two genes are linked, they tend to be inherited together. When two genes are located on the same chromosome or occur very close to each other are said to be linked.
Want to see the full answer?
Check out a sample textbook solutionChapter 5 Solutions
Genetics: From Genes to Genomes, 5th edition
- When the recombination process of a heavy-chain V region is complete, the heavy- and light-chain loci contain an exon that encodes the entire variable region. Which gene segment encodes the first two hypervariable regions and B strands A-F? VH or VL JH or JL DH or DL VH or JHarrow_forwardAn individual is heterozygous for a reciprocal translocation, with the following chromosomes: A • B C D E F A • B C V W X R ST • U D E F R ST • U V W X Q. Draw the products of alternate, adjacent-1, and adjacent-2 segregations.arrow_forwardRecombination frequencies between four genetically-linked loci in corn are shown in the following table: Loci Recombination Frequency (%) L and Q 20 Q and R 50 R and L 30 Q and W 13 L and W 7 What is the order of the genes on the chromosome? (note: The same answer can be represented forward or backwards. e.g. A B C D = D C B A) LQWR RQWL LRQW QRLW RLWQarrow_forward
- Recombination frequencies between four genetically-linked loci in corn are shown in the following table: Loci Recombination Frequency (%) R and Q 45 W and Q 60 R and W 15 Q and L 10 L and R 35 What is the order of the genes on the chromosome? (note: The same answer can be represented forward or backwards. e.g. A B C D = D C B A) RQWL LQWR QWLR QRLW WRLQarrow_forwardThe homologous chromosome pairs in our cells do not carry identical sequences in all loci. This heterozygosity (difference between the two.copies) can be altered in cancer: in fact, loss of heterozygosity at many loci is observed in cancer cells, through an increase in either homozygosity (two identical copies) or hemizygosity (i.e. loss of one copy). Researchers can take advantage of this loss of heterozygosity in cancer cells to identify genomic loci that contain cancer-critical genes. What type of gene would you expect to find in chromosomal regions with a loss of heterozygosity? Proto-oncogenes or tumour suppressor genes? Choose the correct answer here Proto-oncogenes Tumour Suppressor genesarrow_forwardTake a look at question 3 in More Genetic TIPS. Let’s suppose amale is heterozygous for two polymorphic sequence-tagged sites.STS-1 exists in two sizes: 211 bp and 289 bp. STS-2 also exists intwo sizes: 115 bp and 422 bp. A sample of sperm was collectedfrom this man, and individual sperm were placed into 30 separatetubes. Into each of the 30 tubes were added the primers that amplifySTS-1 and STS-2, and then the samples were subjected toPCR. The following results were obtained:arrow_forward
- People who carry a theoretical genetic disorder (called B-disease) can be identified from a 2kb DNA sequence. People who carry this genetic disorder have a single nucleotide polymorphism that results in a change of GTATCC to GGATCC, a site that only occurs once at nucleotide number 750 in this DNA sequence. Answer the following questions based on the information provided. (a) How can you develop a simple molecular test to identify the genetic disorder?r B-dif w. (41 (b) If you have carried out the molecular test (based on the information above) on a 100 individual and found that 24 were healthy (BB) and 26 were carriers (bb); 1) What is the ratio of heterozygous? 2) Show how can you identify the three types from the agarose gel (H focaiarrow_forwardA diploid (ie, contains TWO sets of chromosomes) organisms with a 45,000-kb haploid (counts only one set of its chromosomes) genome contains 21% G residues. Calculate the number of A, C, G< and T residues in the DNA of each cell in this organism. Can you help explain why this is the answer, thank you! Answer: Since the haploid genome contains 21% G, it must contain 21% C (Because G=C) and 58% A + T, or 29% A and 29% T. Each cell is a diploid, containing 90,000 kb or 9x10^7 bases. Therefore, A=T = (0.29)(9x10^7) = 2.61 x 10^7 bases and G=C=(0.21)(9x10^7) = 1.89x10^7 bases.arrow_forwardA molecular biologist is investigating homologous recombination. One aim of this study is to reconstitute stages of the process in vitro. (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5’ GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5’ GTCCCATACGTAGCCGTAGGACATGTACCG 3’ Y 5’ CGGTACATGTCCTACGGCTACAATGCGATC 3’ Z 5’ TTACAGTGGACCTACGGCTACGTATGGGAC 3’ (b) What is branch migration? (c) What is the name of the enzyme that resolves a Holliday junction into two separate DNA duplexes? (d) On your diagram, indicate how the Holliday junction can be resolved in two different ways and draw the structures of the products.arrow_forward
- In an electrophoretic gel across which is applied a powerful electrical alternating pulsed field, the DNA of the haploid fungus Neurospora crassa (n = 7) moves slowly but eventually forms seven bands, which represent DNA fractions that are of different sizes and hence have moved at different speeds. These bands are presumed to be the seven chromosomes. How would you show which band corresponds to which chromosome?arrow_forwardAliens with orang eye color allele (o) is recessive to the dominant black eye color allele (O). The locus of the orange gene from 10 pure breed orange eyes aliens and 10 pure breed black eyes aliens. You notice a difference in the DNA sequence linked to each allele of the orange gene and you decide to use it as a physical marker to follow recombination between this sequence linked to the orange gene. These sequences consist of short tandem repeat (STR) with two different number of repeats, each associated with one of the two orange gene alleles. a PCR test distinguishes the 10 repeat STR and the 6 repeat STR associated with the O and o alleles respectively. Using primers on each side of the STRs you can amplify by PCR this sequence and visualizing the size of the 10 repeat and 6 repeat STRs in an electrophoresis gel. You can follow the two STR sequences (10 and 6 repeats) linkage and recombination frequencies with the orange gene locus. The black eye aliens yield a PCR fragment that is…arrow_forwardA scientist investigating the genome of two related individuals observes a difference of a few nucleotides in one individual compared to the other. The nucleotide differences are in a region of noncoding DNA on chromosome 1. Would these differences be considered a mutation? Why or why not? Yes, the difference in nucleotide sequences between the individuals is a mutation because it will affect the phenotype of the two individuals. Yes, any heritable variation in the nucleotide sequence is considered a mutation, even if that variation is in a noncoding region of DNA. Not enough information was provided to determine if this nucleotide difference is a mutation because the effect on phenotype is unknown. No, the change in nucleotide sequence doesn't appear in a coding region of the DNA and so can't be a mutation.arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning