Biochemistry: The Molecular Basis of Life
6th Edition
ISBN: 9780190209896
Author: Trudy McKee, James R. McKee
Publisher: Oxford University Press
expand_more
expand_more
format_list_bulleted
Question
Chapter 17, Problem 7RQ
Summary Introduction
To review:
The definition of the following terms:
1. A-DNA (deoxyribonucleic acid)
2. B-DNA
3. Z-DNA
4. Cruciform
5. Palindrome
Introduction:
The DNA molecule can exhibit different conformational adaptations. These conformational changes are responsible for the formation of different structural forms of DNA, such as A-DNA, B-DNA, and Z-DNA. Moreover, certain structural segments having a definite ordered structure are found within the DNA structure. These structures include cruciform, which are typically present in palindromic regions.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Hello! Could you kindly assist me in determining if the following statements are true or false? If it is possible, could you write a brief justification to help me comprehend the reason promptly, since I am extremely inexperienced with this topic? Your assistance will undoubtedly aid me in acquiring new information. Thank you!
1. A nucleoside is composed of Sugar and Nucleic Acid-Base.2. The Nucleic Acid base in DNA and RNA are two different set.3. Adenine pairs with Thymine only.4. Amino acid structures contain a Carboxylic group and Amine group.5. he linkage of two amino acids produces a dipeptide and a water molecule.
Mitichondrial DNA is a kind of DNA that is found in the cells of mitochondri Provide a succinct explanation.
Question Number 3: Write the sequence of the mRNA molecule synthesized from a DNA template coding strand having the sequence 5’ – ATCGTACCGTTA – 3
Chapter 17 Solutions
Biochemistry: The Molecular Basis of Life
Ch. 17 - Prob. 1QCh. 17 - Prob. 2QCh. 17 - Prob. 3QCh. 17 - Prob. 4QCh. 17 - Prob. 5QCh. 17 - Prob. 6QCh. 17 - Prob. 7QCh. 17 - Prob. 8QCh. 17 - Prob. 1RQCh. 17 - Prob. 2RQ
Ch. 17 - Prob. 3RQCh. 17 - Prob. 4RQCh. 17 - Prob. 5RQCh. 17 - Prob. 6RQCh. 17 - Prob. 7RQCh. 17 - Prob. 8RQCh. 17 - Prob. 9RQCh. 17 - Prob. 10RQCh. 17 - Prob. 11RQCh. 17 - Prob. 12RQCh. 17 - Prob. 13RQCh. 17 - Prob. 14RQCh. 17 - Prob. 15RQCh. 17 - Prob. 16RQCh. 17 - Prob. 17RQCh. 17 - Prob. 18RQCh. 17 - Prob. 19RQCh. 17 - Prob. 20RQCh. 17 - Prob. 21RQCh. 17 - Prob. 22RQCh. 17 - Prob. 23RQCh. 17 - Prob. 24RQCh. 17 - Prob. 25RQCh. 17 - Prob. 26RQCh. 17 - Prob. 27RQCh. 17 - Prob. 28RQCh. 17 - Prob. 29RQCh. 17 - Prob. 30RQCh. 17 - Prob. 31RQCh. 17 - Prob. 32RQCh. 17 - Prob. 33RQCh. 17 - Prob. 34RQCh. 17 - Prob. 35RQCh. 17 - Prob. 36RQCh. 17 - Prob. 37RQCh. 17 - Prob. 38RQCh. 17 - Prob. 39RQCh. 17 - Prob. 40RQCh. 17 - Prob. 41FBCh. 17 - Prob. 42FBCh. 17 - Prob. 43FBCh. 17 - Prob. 44FBCh. 17 - Prob. 45FBCh. 17 - Prob. 46FBCh. 17 - Prob. 47FBCh. 17 - Prob. 48FBCh. 17 - Prob. 49FBCh. 17 - Prob. 50FBCh. 17 - Prob. 51SACh. 17 - Prob. 52SACh. 17 - Prob. 53SACh. 17 - Prob. 54SACh. 17 - Prob. 55SACh. 17 - Prob. 56TQCh. 17 - Prob. 57TQCh. 17 - Prob. 58TQCh. 17 - Prob. 59TQCh. 17 - Prob. 60TQCh. 17 - Prob. 61TQCh. 17 - Prob. 62TQCh. 17 - Prob. 63TQCh. 17 - Prob. 64TQCh. 17 - Prob. 65TQCh. 17 - Prob. 66TQCh. 17 - Prob. 67TQCh. 17 - Prob. 68TQCh. 17 - Prob. 69TQCh. 17 - Prob. 70TQCh. 17 - Prob. 71TQCh. 17 - Prob. 72TQCh. 17 - Prob. 73TQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- what is the purpose of the Sorenson indexarrow_forwardTrue or False for each question ( ) Guanine, Adenine, Uracil, and Cytosine are commonly found in both DNA and RNA. ( ) The DNA nucleotide sequence was elucidated by Watson and Crick from considerations of x-ray structure data generated by Rosalind Franklin, Chargaff’s rule, and molecular modeling. ( ) The phosphodiester backbone in major grooves in DNA are closer together than in minor grooves. ( ) Major grooves in DNA are often sites where DNA-binding proteins bind. ( ) Base stacking in DNA results in hydrophobic effects and van der Waals interactions that provide stability to the DNA double helix. ( ) Due to stacking interaction, double-stranded DNA absorbs less light at 260 nm than light absorbed by single-stranded DNA. ( ) DNA melting temperature (Tm) for a region of DNA is the temperature at which all of the DNA molecules are denatured to the single-stranded state. ( ) Sequences rich in G-C base pairs have more stability than…arrow_forwardQuestion 1 Please take the following sequence of DNA and perform 1) DNA Synthesis, 2) Transcription, and 3) Translation in that order. The sequence you get after doing DNA synthesis use for doing Transcription. The sequence you get from transcription use for doing translation. CCATGTTCCTCACCGGGCTATTCAATAAATAAC Answer = 1) ___________________________________________________ 2) ___________________________________________________ 3) ___________________________________________________ asaparrow_forward
- QUESTION 24 During lagging strand synthesis of DNA, Okazaki fragments are linked together by ___________. DNA polymerase I Primase Beta clamps DNA Ligasearrow_forwardquestion 13 The nucleic acid of a virus is A DNA only B RNA only C both DNA and RNA D either DNA and RNAarrow_forwardQuestion 1. The nitrogenous base content of a sample of DNA was found to be 34% adenine. Determine the amounts of the other three bases in this sample.arrow_forward
- QUESTION 25 During lagging strand synthesis of DNA, the RNA primers are replaced with DNA by __________. DNA Polymerase I DNA Polymerase II DNA Polymerase III Primasearrow_forwardCytidine is a nitrogenous base or nucleosides?arrow_forwardQuestion 46 The degeneracy of the genetic code most often involves: the third base of the codon the second base of the codon the first base of the codon two bases of the codon Question 47 Immunological memory is an important feature of: the adaptive immune system the innate immune system Neutrophils macrophagesarrow_forward
- QUESTION 22 The DNA sequences that are most conserved between human and mouse would most likely be located in: A Highly-repeated sequences, such as microsatellite regions B Highly repeated sequences, such as Alu sequences C Moderately-repeated non-coding sequences D Coding regions of single-copy genesarrow_forward398 was also not the answer to the number of GTP molecules.arrow_forwardWhat is the difference between DNA and ARNarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
DNA Use In Forensic Science; Author: DeBacco University;https://www.youtube.com/watch?v=2YIG3lUP-74;License: Standard YouTube License, CC-BY
Analysing forensic evidence | The Laboratory; Author: Wellcome Collection;https://www.youtube.com/watch?v=68Y-OamcTJ8;License: Standard YouTube License, CC-BY