Biochemistry: The Molecular Basis of Life
6th Edition
ISBN: 9780190209896
Author: Trudy McKee, James R. McKee
Publisher: Oxford University Press
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 17, Problem 37RQ
Summary Introduction
To review:
The evidence used by Watson and Crick to construct the Deoxyribose
Introduction:
The structure of DNA is composed of two antiparallel strands of the polynucleotide chain. The backbone is composed of sugar–phosphate bonds. The nitrogenous bases, which are adenine, thymine, cytosin, end guanin, ere stacked in the center. They are linked to the backbone by the phosphodiester bonds. The number of purines equals the number of pyrimidines. There are three major forms of DNA, namely A-DNA, B-DN, And Z-DNA. The most common form of DNA is B-DNA.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
What are the Okazaki fragments?
Mitichondrial DNA is a kind of DNA that is found in the cells of mitochondri Provide a succinct explanation.
Question Number 3: Write the sequence of the mRNA molecule synthesized from a DNA template coding strand having the sequence 5’ – ATCGTACCGTTA – 3
Chapter 17 Solutions
Biochemistry: The Molecular Basis of Life
Ch. 17 - Prob. 1QCh. 17 - Prob. 2QCh. 17 - Prob. 3QCh. 17 - Prob. 4QCh. 17 - Prob. 5QCh. 17 - Prob. 6QCh. 17 - Prob. 7QCh. 17 - Prob. 8QCh. 17 - Prob. 1RQCh. 17 - Prob. 2RQ
Ch. 17 - Prob. 3RQCh. 17 - Prob. 4RQCh. 17 - Prob. 5RQCh. 17 - Prob. 6RQCh. 17 - Prob. 7RQCh. 17 - Prob. 8RQCh. 17 - Prob. 9RQCh. 17 - Prob. 10RQCh. 17 - Prob. 11RQCh. 17 - Prob. 12RQCh. 17 - Prob. 13RQCh. 17 - Prob. 14RQCh. 17 - Prob. 15RQCh. 17 - Prob. 16RQCh. 17 - Prob. 17RQCh. 17 - Prob. 18RQCh. 17 - Prob. 19RQCh. 17 - Prob. 20RQCh. 17 - Prob. 21RQCh. 17 - Prob. 22RQCh. 17 - Prob. 23RQCh. 17 - Prob. 24RQCh. 17 - Prob. 25RQCh. 17 - Prob. 26RQCh. 17 - Prob. 27RQCh. 17 - Prob. 28RQCh. 17 - Prob. 29RQCh. 17 - Prob. 30RQCh. 17 - Prob. 31RQCh. 17 - Prob. 32RQCh. 17 - Prob. 33RQCh. 17 - Prob. 34RQCh. 17 - Prob. 35RQCh. 17 - Prob. 36RQCh. 17 - Prob. 37RQCh. 17 - Prob. 38RQCh. 17 - Prob. 39RQCh. 17 - Prob. 40RQCh. 17 - Prob. 41FBCh. 17 - Prob. 42FBCh. 17 - Prob. 43FBCh. 17 - Prob. 44FBCh. 17 - Prob. 45FBCh. 17 - Prob. 46FBCh. 17 - Prob. 47FBCh. 17 - Prob. 48FBCh. 17 - Prob. 49FBCh. 17 - Prob. 50FBCh. 17 - Prob. 51SACh. 17 - Prob. 52SACh. 17 - Prob. 53SACh. 17 - Prob. 54SACh. 17 - Prob. 55SACh. 17 - Prob. 56TQCh. 17 - Prob. 57TQCh. 17 - Prob. 58TQCh. 17 - Prob. 59TQCh. 17 - Prob. 60TQCh. 17 - Prob. 61TQCh. 17 - Prob. 62TQCh. 17 - Prob. 63TQCh. 17 - Prob. 64TQCh. 17 - Prob. 65TQCh. 17 - Prob. 66TQCh. 17 - Prob. 67TQCh. 17 - Prob. 68TQCh. 17 - Prob. 69TQCh. 17 - Prob. 70TQCh. 17 - Prob. 71TQCh. 17 - Prob. 72TQCh. 17 - Prob. 73TQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- What feature of eukaryotic translation is especially responsible for its efficiency?arrow_forwardHello , please help me with this question. I am struggling with naming the Amino Acid sequence from the RNA sequence . thank you ,arrow_forwardWho was left out by watson and crick when they wrote their paper about the structure of dnaarrow_forward
- What base is found in RNAarrow_forwardTrue or False for each question ( ) Guanine, Adenine, Uracil, and Cytosine are commonly found in both DNA and RNA. ( ) The DNA nucleotide sequence was elucidated by Watson and Crick from considerations of x-ray structure data generated by Rosalind Franklin, Chargaff’s rule, and molecular modeling. ( ) The phosphodiester backbone in major grooves in DNA are closer together than in minor grooves. ( ) Major grooves in DNA are often sites where DNA-binding proteins bind. ( ) Base stacking in DNA results in hydrophobic effects and van der Waals interactions that provide stability to the DNA double helix. ( ) Due to stacking interaction, double-stranded DNA absorbs less light at 260 nm than light absorbed by single-stranded DNA. ( ) DNA melting temperature (Tm) for a region of DNA is the temperature at which all of the DNA molecules are denatured to the single-stranded state. ( ) Sequences rich in G-C base pairs have more stability than…arrow_forwardQUESTION 24 During lagging strand synthesis of DNA, Okazaki fragments are linked together by ___________. DNA polymerase I Primase Beta clamps DNA Ligasearrow_forward
- Question 46 The degeneracy of the genetic code most often involves: the third base of the codon the second base of the codon the first base of the codon two bases of the codon Question 47 Immunological memory is an important feature of: the adaptive immune system the innate immune system Neutrophils macrophagesarrow_forwardQuestion 1 Please take the following sequence of DNA and perform 1) DNA Synthesis, 2) Transcription, and 3) Translation in that order. The sequence you get after doing DNA synthesis use for doing Transcription. The sequence you get from transcription use for doing translation. CCATGTTCCTCACCGGGCTATTCAATAAATAAC Answer = 1) ___________________________________________________ 2) ___________________________________________________ 3) ___________________________________________________ asaparrow_forward398 was also not the answer to the number of GTP molecules.arrow_forward
- Topic is central dogma of molecular biology Question: 4. Assuming the translation product is an enzyme, explain its role in the final expression of a phenotype. Please explain it to me thank youarrow_forwardAdenine is a niterogenous base or nucleosides?arrow_forwardWhat is unusual about the answers for Questions 13k, 13l, 13m, and 13n? Because the multiple codons exist for most amino acids, the genetic code is said to be _____________.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY