Biochemistry: The Molecular Basis of Life
6th Edition
ISBN: 9780190209896
Author: Trudy McKee, James R. McKee
Publisher: Oxford University Press
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 17, Problem 15RQ
Summary Introduction
To review:
The three differences between eukaryotic and prokaryotic DNA (deoxyribonucleic acid).
Introduction:
Eukaryotes are the organisms having amembrane-bound nucleus in their cells, while prokaryotes (bacteria) lack this feature. DNA (Deoxyribonucleic acid) is a molecule present inside the nucleus of the eukaryotic cell and contains genetic information.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Question Number 3: Write the sequence of the mRNA molecule synthesized from a DNA template coding strand having the sequence 5’ – ATCGTACCGTTA – 3
Mitichondrial DNA is a kind of DNA that is found in the cells of mitochondri Provide a succinct explanation.
QUESTION 24
During lagging strand synthesis of DNA, Okazaki fragments are linked together by ___________.
DNA polymerase I
Primase
Beta clamps
DNA Ligase
Chapter 17 Solutions
Biochemistry: The Molecular Basis of Life
Ch. 17 - Prob. 1QCh. 17 - Prob. 2QCh. 17 - Prob. 3QCh. 17 - Prob. 4QCh. 17 - Prob. 5QCh. 17 - Prob. 6QCh. 17 - Prob. 7QCh. 17 - Prob. 8QCh. 17 - Prob. 1RQCh. 17 - Prob. 2RQ
Ch. 17 - Prob. 3RQCh. 17 - Prob. 4RQCh. 17 - Prob. 5RQCh. 17 - Prob. 6RQCh. 17 - Prob. 7RQCh. 17 - Prob. 8RQCh. 17 - Prob. 9RQCh. 17 - Prob. 10RQCh. 17 - Prob. 11RQCh. 17 - Prob. 12RQCh. 17 - Prob. 13RQCh. 17 - Prob. 14RQCh. 17 - Prob. 15RQCh. 17 - Prob. 16RQCh. 17 - Prob. 17RQCh. 17 - Prob. 18RQCh. 17 - Prob. 19RQCh. 17 - Prob. 20RQCh. 17 - Prob. 21RQCh. 17 - Prob. 22RQCh. 17 - Prob. 23RQCh. 17 - Prob. 24RQCh. 17 - Prob. 25RQCh. 17 - Prob. 26RQCh. 17 - Prob. 27RQCh. 17 - Prob. 28RQCh. 17 - Prob. 29RQCh. 17 - Prob. 30RQCh. 17 - Prob. 31RQCh. 17 - Prob. 32RQCh. 17 - Prob. 33RQCh. 17 - Prob. 34RQCh. 17 - Prob. 35RQCh. 17 - Prob. 36RQCh. 17 - Prob. 37RQCh. 17 - Prob. 38RQCh. 17 - Prob. 39RQCh. 17 - Prob. 40RQCh. 17 - Prob. 41FBCh. 17 - Prob. 42FBCh. 17 - Prob. 43FBCh. 17 - Prob. 44FBCh. 17 - Prob. 45FBCh. 17 - Prob. 46FBCh. 17 - Prob. 47FBCh. 17 - Prob. 48FBCh. 17 - Prob. 49FBCh. 17 - Prob. 50FBCh. 17 - Prob. 51SACh. 17 - Prob. 52SACh. 17 - Prob. 53SACh. 17 - Prob. 54SACh. 17 - Prob. 55SACh. 17 - Prob. 56TQCh. 17 - Prob. 57TQCh. 17 - Prob. 58TQCh. 17 - Prob. 59TQCh. 17 - Prob. 60TQCh. 17 - Prob. 61TQCh. 17 - Prob. 62TQCh. 17 - Prob. 63TQCh. 17 - Prob. 64TQCh. 17 - Prob. 65TQCh. 17 - Prob. 66TQCh. 17 - Prob. 67TQCh. 17 - Prob. 68TQCh. 17 - Prob. 69TQCh. 17 - Prob. 70TQCh. 17 - Prob. 71TQCh. 17 - Prob. 72TQCh. 17 - Prob. 73TQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Hello! Could you kindly assist me in determining if the following statements are true or false? If it is possible, could you write a brief justification to help me comprehend the reason promptly, since I am extremely inexperienced with this topic? Your assistance will undoubtedly aid me in acquiring new information. Thank you! 1. A nucleoside is composed of Sugar and Nucleic Acid-Base.2. The Nucleic Acid base in DNA and RNA are two different set.3. Adenine pairs with Thymine only.4. Amino acid structures contain a Carboxylic group and Amine group.5. he linkage of two amino acids produces a dipeptide and a water molecule.arrow_forwardAdenine is a niterogenous base or nucleosides?arrow_forwardQUESTION 25 During lagging strand synthesis of DNA, the RNA primers are replaced with DNA by __________. DNA Polymerase I DNA Polymerase II DNA Polymerase III Primasearrow_forward
- What feature of eukaryotic translation is especially responsible for its efficiency?arrow_forwardQuestion 1 Please take the following sequence of DNA and perform 1) DNA Synthesis, 2) Transcription, and 3) Translation in that order. The sequence you get after doing DNA synthesis use for doing Transcription. The sequence you get from transcription use for doing translation. CCATGTTCCTCACCGGGCTATTCAATAAATAAC Answer = 1) ___________________________________________________ 2) ___________________________________________________ 3) ___________________________________________________ asaparrow_forwardQuestion 46 The degeneracy of the genetic code most often involves: the third base of the codon the second base of the codon the first base of the codon two bases of the codon Question 47 Immunological memory is an important feature of: the adaptive immune system the innate immune system Neutrophils macrophagesarrow_forward
- True or False for each question ( ) Guanine, Adenine, Uracil, and Cytosine are commonly found in both DNA and RNA. ( ) The DNA nucleotide sequence was elucidated by Watson and Crick from considerations of x-ray structure data generated by Rosalind Franklin, Chargaff’s rule, and molecular modeling. ( ) The phosphodiester backbone in major grooves in DNA are closer together than in minor grooves. ( ) Major grooves in DNA are often sites where DNA-binding proteins bind. ( ) Base stacking in DNA results in hydrophobic effects and van der Waals interactions that provide stability to the DNA double helix. ( ) Due to stacking interaction, double-stranded DNA absorbs less light at 260 nm than light absorbed by single-stranded DNA. ( ) DNA melting temperature (Tm) for a region of DNA is the temperature at which all of the DNA molecules are denatured to the single-stranded state. ( ) Sequences rich in G-C base pairs have more stability than…arrow_forwardwhat is the purpose of the Sorenson indexarrow_forwardWhat base is found in RNAarrow_forward
- What is the meaning of the statement “The code is redundant but not ambiguous?”.arrow_forwardQuestion 1. Although we will not be doing a gel electrophoresis, data from a gel digest of a Bacillus anthrax plasmid is provided so you can do a DNA map. The Bacillus anthrax plasmid is 4000bp (4Kb) long. Note the origin position as well as the reference molecular weight markers on the gel. Two restriction enzymes, A and B, were used to obtain two individual digests, A and B. They were combined to produce the third digest. The restriction enzyme fragment pattern for the digest of Bacillus anthrax plasmid Determining the Number of Fragments How many fragments were produced by enzyme A? How many fragments were produced by enzyme B? How many fragments were produced by the combined digest (A and B)? Fragment Size Fragment size is relative to molecular weight, and must be determined by comparing the fragment distance to the molecular weight markers. The fragment size has been provided on the gel pattern for this exercise. To make a map you must determine the relative positions of the…arrow_forwardQUESTION NO. 1 Base excision repair A. is used only for bases that have been deaminated. B. uses enzymes called DNA glycosylases to generate an abasic sugar site. C. removes about 10 to 15 nucleotides. D. does not require an endonuclease. E. recognizes a bulky lesion. QUESTION NO. 2 Termination of a prokaryotic transcriptA. is a random process. B. requires the presence of the rho subunit of the holoenzyme. C. does not require rho factor if the end of the gene contains a G-C rich palindrome. D. is most efficient if there is an A-T-rich segment at the end of the gene. E. requires an ATPase in addition to rho factor. QUESTION NO. 3 Eukaryotic transcription A. is independent of the presence of upstream consensus sequences. B. may involve a promoter located within the region transcribed rather than upstream. C. requires a separate promoter region for each of the three ribosomal RNAs transcribed. D. requires that…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON